https://launchpad.net/ubuntu/+archive/test-rebuild-20240502-noble-gcc/+build/28294924
RUN: /usr/share/launchpad-buildd/bin/builder-prep 
Kernel version: Linux bos02-s390x-011 5.4.0-182-generic #202-Ubuntu SMP Fri Apr 26 12:29:12 UTC 2024 s390x
Buildd toolchain package versions: launchpad-buildd_237~660~ubuntu20.04.1 python3-lpbuildd_237~660~ubuntu20.04.1 sbuild_0.79.0-1ubuntu1 git-build-recipe_0.3.6 git_1:2.25.1-1ubuntu3.11 dpkg-dev_1.19.7ubuntu3.2 python3-debian_0.1.36ubuntu1.1.
Syncing the system clock with the buildd NTP service...
18 May 19:43:19 ntpdate[1865]: adjust time server 10.211.37.1 offset -0.000197 sec
RUN: /usr/share/launchpad-buildd/bin/in-target unpack-chroot --backend=chroot --series=noble --arch=s390x PACKAGEBUILD-28294924 --image-type chroot /home/buildd/filecache-default/c23f799bb684944311373fdcead5a58221fa6ef7
Creating target for build PACKAGEBUILD-28294924
RUN: /usr/share/launchpad-buildd/bin/in-target mount-chroot --backend=chroot --series=noble --arch=s390x PACKAGEBUILD-28294924
Starting target for build PACKAGEBUILD-28294924
RUN: /usr/share/launchpad-buildd/bin/in-target override-sources-list --backend=chroot --series=noble --arch=s390x PACKAGEBUILD-28294924 'deb http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble main' 'deb http://ppa.launchpadcontent.net/ubuntu-toolchain-r/volatile/ubuntu noble main' 'deb http://ftpmaster.internal/ubuntu noble main universe'
Overriding sources.list in build-PACKAGEBUILD-28294924
RUN: /usr/share/launchpad-buildd/bin/in-target add-trusted-keys --backend=chroot --series=noble --arch=s390x PACKAGEBUILD-28294924
Adding trusted keys to build-PACKAGEBUILD-28294924
pub   rsa1024/1E9377A2BA9EF27F 2009-10-22 [SC]
      Key fingerprint = 60C3 1780 3A41 BA51 845E  371A 1E93 77A2 BA9E F27F
uid                            Launchpad Toolchain builds

RUN: /usr/share/launchpad-buildd/bin/in-target update-debian-chroot --backend=chroot --series=noble --arch=s390x PACKAGEBUILD-28294924
Updating target for build PACKAGEBUILD-28294924
Get:1 http://ftpmaster.internal/ubuntu noble InRelease [256 kB]
Get:2 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble InRelease [23.6 kB]
Get:3 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/volatile/ubuntu noble InRelease [23.6 kB]
Get:4 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x Packages [24.5 kB]
Get:5 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main Translation-en [14.9 kB]
Get:6 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/volatile/ubuntu noble/main s390x Packages [17.7 kB]
Get:7 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/volatile/ubuntu noble/main Translation-en [4996 B]
Get:8 http://ftpmaster.internal/ubuntu noble/main s390x Packages [1324 kB]
Get:9 http://ftpmaster.internal/ubuntu noble/main Translation-en [513 kB]
Get:10 http://ftpmaster.internal/ubuntu noble/universe s390x Packages [14.2 MB]
Get:11 http://ftpmaster.internal/ubuntu noble/universe Translation-en [5982 kB]
Fetched 22.4 MB in 4s (5163 kB/s)
Reading package lists...
Reading package lists...
Building dependency tree...
Reading state information...
Calculating upgrade...
The following packages were automatically installed and are no longer required:
  cpp-13 g++-13 g++-13-s390x-linux-gnu libnsl-dev libperl5.36 libstdc++-13-dev
  libtirpc-dev libunistring2 perl-modules-5.36
Use 'sudo apt autoremove' to remove them.
The following packages will be REMOVED:
  libapt-pkg6.0* libdb5.3* libext2fs2* libgdbm-compat4* libgdbm6* libgnutls30*
  libhogweed6* libnettle8* libnpth0* libpng16-16* libreadline8* libssl3*
  libtirpc3* usrmerge*
The following NEW packages will be installed:
  cpp-13-s390x-linux-gnu cpp-14 cpp-14-s390x-linux-gnu cpp-s390x-linux-gnu
  g++-13-s390x-linux-gnu g++-14 g++-14-s390x-linux-gnu g++-s390x-linux-gnu
  gcc-13-s390x-linux-gnu gcc-14 gcc-14-base gcc-14-s390x-linux-gnu
  gcc-s390x-linux-gnu libapt-pkg6.0t64 libdb5.3t64 libext2fs2t64 libgcc-14-dev
  libgdbm-compat4t64 libgdbm6t64 libgnutls30t64 libhogweed6t64 libnettle8t64
  libnpth0t64 libperl5.38t64 libpng16-16t64 libreadline8t64 libssl3t64
  libstdc++-14-dev libtirpc3t64 libunistring5 perl-modules-5.38
The following packages will be upgraded:
  advancecomp apt apt-utils base-files base-passwd bash bash-completion
  binutils binutils-common binutils-s390x-linux-gnu bsdextrautils bsdutils
  bzip2 ca-certificates coreutils cpp cpp-13 dash debconf debconf-i18n
  debianutils diffutils dpkg dpkg-dev e2fsprogs fakeroot findutils g++ g++-13
  gcc gcc-13 gcc-13-base gpg gpg-agent gpgconf gpgv grep gzip hostname init
  init-system-helpers krb5-locales libacl1 libapparmor1 libargon2-1 libasan8
  libassuan0 libatomic1 libattr1 libaudit-common libaudit1 libbinutils
  libblkid1 libbz2-1.0 libc-bin libc-dev-bin libc6 libc6-dev libcap-ng0
  libcap2 libcc1-0 libcom-err2 libcrypt-dev libcrypt1 libcryptsetup12
  libctf-nobfd0 libctf0 libdebconfclient0 libdevmapper1.02.1 libdpkg-perl
  libfakeroot libfdisk1 libffi8 libgcc-13-dev libgcc-s1 libgcrypt20 libgmp10
  libgomp1 libgpg-error-l10n libgpg-error0 libgpm2 libgssapi-krb5-2 libidn2-0
  libip4tc2 libisl23 libitm1 libjansson4 libjson-c5 libk5crypto3 libkeyutils1
  libkmod2 libkrb5-3 libkrb5support0 liblocale-gettext-perl liblockfile-bin
  liblockfile1 liblz4-1 liblzma5 libmd0 libmount1 libmpc3 libmpfr6
  libncursesw6 libnsl-dev libnsl2 libnss-nis libnss-nisplus libp11-kit0
  libpam-modules libpam-modules-bin libpam-runtime libpam0g libpcre2-8-0
  libproc2-0 libseccomp2 libselinux1 libsemanage-common libsemanage2 libsepol2
  libsframe1 libsmartcols1 libsqlite3-0 libss2 libstdc++-13-dev libstdc++6
  libsystemd-shared libsystemd0 libtasn1-6 libtext-charwidth-perl
  libtext-iconv-perl libtinfo6 libtirpc-common libtirpc-dev libubsan1 libudev1
  libuuid1 libxxhash0 libzstd1 linux-libc-dev lockfile-progs login logsave
  lto-disabled-list make mawk mount ncurses-base ncurses-bin openssl optipng
  passwd patch perl perl-base pinentry-curses procps psmisc readline-common
  rpcsvc-proto sed sensible-utils systemd systemd-dev systemd-sysv
  sysvinit-utils tar tzdata ubuntu-keyring util-linux uuid-runtime xz-utils
  zlib1g
172 upgraded, 31 newly installed, 14 to remove and 0 not upgraded.
Need to get 392 MB of archives.
After this operation, 1022 MB of additional disk space will be used.
Get:1 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x gcc-14-base s390x 14-20240429-1ubuntu1 [48.0 kB]
Get:2 http://ftpmaster.internal/ubuntu noble/main s390x libtirpc-common all 1.3.4+ds-1.1build1 [8094 B]
Get:3 http://ftpmaster.internal/ubuntu noble/main s390x libtirpc-dev s390x 1.3.4+ds-1.1build1 [197 kB]
Get:4 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x libgcc-s1 s390x 14-20240429-1ubuntu1 [35.8 kB]
Get:5 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x libstdc++6 s390x 14-20240429-1ubuntu1 [905 kB]
Get:6 http://ftpmaster.internal/ubuntu noble/main s390x libnsl-dev s390x 1.3.0-3build3 [73.1 kB]
Get:7 http://ftpmaster.internal/ubuntu noble/main s390x libnsl2 s390x 1.3.0-3build3 [44.1 kB]
Get:8 http://ftpmaster.internal/ubuntu noble/main s390x libtirpc3t64 s390x 1.3.4+ds-1.1build1 [85.9 kB]
Get:9 http://ftpmaster.internal/ubuntu noble/main s390x libgssapi-krb5-2 s390x 1.20.1-6ubuntu2 [149 kB]
Get:10 http://ftpmaster.internal/ubuntu noble/main s390x libkrb5-3 s390x 1.20.1-6ubuntu2 [360 kB]
Get:11 http://ftpmaster.internal/ubuntu noble/main s390x libk5crypto3 s390x 1.20.1-6ubuntu2 [90.3 kB]
Get:12 http://ftpmaster.internal/ubuntu noble/main s390x libkrb5support0 s390x 1.20.1-6ubuntu2 [34.7 kB]
Get:13 http://ftpmaster.internal/ubuntu noble/main s390x libacl1 s390x 2.3.2-1build1 [18.0 kB]
Get:14 http://ftpmaster.internal/ubuntu noble/main s390x libapparmor1 s390x 4.0.0-beta3-0ubuntu3 [50.8 kB]
Get:15 http://ftpmaster.internal/ubuntu noble/main s390x libaudit-common all 1:3.1.2-2.1build1 [5736 B]
Get:16 http://ftpmaster.internal/ubuntu noble/main s390x libcap-ng0 s390x 0.8.4-2build2 [15.8 kB]
Get:17 http://ftpmaster.internal/ubuntu noble/main s390x libaudit1 s390x 1:3.1.2-2.1build1 [48.9 kB]
Get:18 http://ftpmaster.internal/ubuntu noble/main s390x libblkid1 s390x 2.39.3-9ubuntu6 [128 kB]
Get:19 http://ftpmaster.internal/ubuntu noble/main s390x libcap2 s390x 1:2.66-5ubuntu2 [31.8 kB]
Get:20 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x cpp-14-s390x-linux-gnu s390x 14-20240429-1ubuntu1 [86.9 MB]
Get:21 http://ftpmaster.internal/ubuntu noble/main s390x libcrypt-dev s390x 1:4.4.36-4build1 [119 kB]
Get:22 http://ftpmaster.internal/ubuntu noble/main s390x libcrypt1 s390x 1:4.4.36-4build1 [88.9 kB]
Get:23 http://ftpmaster.internal/ubuntu noble/main s390x libgpg-error-l10n all 1.47-3build2 [8064 B]
Get:24 http://ftpmaster.internal/ubuntu noble/main s390x libgpg-error0 s390x 1.47-3build2 [75.6 kB]
Get:25 http://ftpmaster.internal/ubuntu noble/main s390x libgcrypt20 s390x 1.10.3-2build1 [501 kB]
Get:26 http://ftpmaster.internal/ubuntu noble/main s390x liblzma5 s390x 5.6.1+really5.4.5-1 [135 kB]
Get:27 http://ftpmaster.internal/ubuntu noble/main s390x libzstd1 s390x 1.5.5+dfsg2-2build1 [341 kB]
Get:28 http://ftpmaster.internal/ubuntu noble/main s390x libkmod2 s390x 31+20240202-2ubuntu7 [56.4 kB]
Get:29 http://ftpmaster.internal/ubuntu noble/main s390x liblz4-1 s390x 1.9.4-1build1 [79.4 kB]
Get:30 http://ftpmaster.internal/ubuntu noble/main s390x libpcre2-8-0 s390x 10.42-4ubuntu2 [245 kB]
Get:31 http://ftpmaster.internal/ubuntu noble/main s390x libselinux1 s390x 3.5-2ubuntu2 [84.8 kB]
Get:32 http://ftpmaster.internal/ubuntu noble/main s390x libmount1 s390x 2.39.3-9ubuntu6 [138 kB]
Get:33 http://ftpmaster.internal/ubuntu noble/main s390x perl-modules-5.38 all 5.38.2-3.2build2 [3110 kB]
Get:34 http://ftpmaster.internal/ubuntu noble/main s390x libdb5.3t64 s390x 5.3.28+dfsg2-7 [764 kB]
Get:35 http://ftpmaster.internal/ubuntu noble/main s390x libgdbm6t64 s390x 1.23-5.1build1 [36.5 kB]
Get:36 http://ftpmaster.internal/ubuntu noble/main s390x libgdbm-compat4t64 s390x 1.23-5.1build1 [6890 B]
Get:37 http://ftpmaster.internal/ubuntu noble/main s390x libperl5.38t64 s390x 5.38.2-3.2build2 [5006 kB]
Get:38 http://ftpmaster.internal/ubuntu noble/main s390x perl s390x 5.38.2-3.2build2 [231 kB]
Get:39 http://ftpmaster.internal/ubuntu noble/main s390x perl-base s390x 5.38.2-3.2build2 [1968 kB]
Get:40 http://ftpmaster.internal/ubuntu noble/main s390x liblocale-gettext-perl s390x 1.07-6ubuntu5 [15.8 kB]
Get:41 http://ftpmaster.internal/ubuntu noble/main s390x libtext-iconv-perl s390x 1.7-8build3 [13.8 kB]
Get:42 http://ftpmaster.internal/ubuntu noble/main s390x libtext-charwidth-perl s390x 0.04-11build3 [9518 B]
Get:43 http://ftpmaster.internal/ubuntu noble/universe s390x libnss-nisplus s390x 1.3-5build1 [23.8 kB]
Get:44 http://ftpmaster.internal/ubuntu noble/universe s390x libnss-nis s390x 3.1-0ubuntu7 [28.3 kB]
Get:45 http://ftpmaster.internal/ubuntu noble/main s390x libc-dev-bin s390x 2.39-0ubuntu8 [20.2 kB]
Get:46 http://ftpmaster.internal/ubuntu noble/main s390x rpcsvc-proto s390x 1.4.2-0ubuntu7 [66.4 kB]
Get:47 http://ftpmaster.internal/ubuntu noble/main s390x libc6-dev s390x 2.39-0ubuntu8 [1629 kB]
Get:48 http://ftpmaster.internal/ubuntu noble/main s390x libc6 s390x 2.39-0ubuntu8 [2847 kB]
Get:49 http://ftpmaster.internal/ubuntu noble/main s390x libc-bin s390x 2.39-0ubuntu8 [654 kB]
Get:50 http://ftpmaster.internal/ubuntu noble/main s390x openssl s390x 3.0.13-0ubuntu3 [1009 kB]
Get:51 http://ftpmaster.internal/ubuntu noble/main s390x libsystemd-shared s390x 255.4-1ubuntu8 [2131 kB]
Get:52 http://ftpmaster.internal/ubuntu noble/main s390x libcryptsetup12 s390x 2:2.7.0-1ubuntu4 [264 kB]
Get:53 http://ftpmaster.internal/ubuntu noble/main s390x libssl3t64 s390x 3.0.13-0ubuntu3 [1675 kB]
Get:54 http://ftpmaster.internal/ubuntu noble/main s390x systemd-dev all 255.4-1ubuntu8 [104 kB]
Get:55 http://ftpmaster.internal/ubuntu noble/main s390x systemd-sysv s390x 255.4-1ubuntu8 [11.9 kB]
Get:56 http://ftpmaster.internal/ubuntu noble/main s390x systemd s390x 255.4-1ubuntu8 [3533 kB]
Get:57 http://ftpmaster.internal/ubuntu noble/main s390x libsystemd0 s390x 255.4-1ubuntu8 [443 kB]
Get:58 http://ftpmaster.internal/ubuntu noble/main s390x libpam-modules-bin s390x 1.5.3-5ubuntu5 [57.2 kB]
Get:59 http://ftpmaster.internal/ubuntu noble/main s390x libpam-modules s390x 1.5.3-5ubuntu5 [289 kB]
Get:60 http://ftpmaster.internal/ubuntu noble/main s390x libnettle8t64 s390x 3.9.1-2.2build1 [210 kB]
Get:61 http://ftpmaster.internal/ubuntu noble/main s390x libhogweed6t64 s390x 3.9.1-2.2build1 [204 kB]
Get:62 http://ftpmaster.internal/ubuntu noble/main s390x libp11-kit0 s390x 0.25.3-4ubuntu2 [320 kB]
Get:63 http://ftpmaster.internal/ubuntu noble/main s390x libunistring5 s390x 1.1-2build1 [550 kB]
Get:64 http://ftpmaster.internal/ubuntu noble/main s390x libgnutls30t64 s390x 3.8.3-1.1ubuntu3 [944 kB]
Get:65 http://ftpmaster.internal/ubuntu noble/main s390x libapt-pkg6.0t64 s390x 2.7.14build2 [1014 kB]
Get:66 http://ftpmaster.internal/ubuntu noble/main s390x bzip2 s390x 1.0.8-5.1 [35.5 kB]
Get:67 http://ftpmaster.internal/ubuntu noble/main s390x libbz2-1.0 s390x 1.0.8-5.1 [40.0 kB]
Get:68 http://ftpmaster.internal/ubuntu noble/main s390x libudev1 s390x 255.4-1ubuntu8 [178 kB]
Get:69 http://ftpmaster.internal/ubuntu noble/main s390x libxxhash0 s390x 0.8.2-2build1 [24.1 kB]
Get:70 http://ftpmaster.internal/ubuntu noble/main s390x zlib1g s390x 1:1.3.dfsg-3.1ubuntu2 [75.9 kB]
Get:71 http://ftpmaster.internal/ubuntu noble/main s390x libgmp10 s390x 2:6.3.0+dfsg-2ubuntu6 [337 kB]
Get:72 http://ftpmaster.internal/ubuntu noble/main s390x libffi8 s390x 3.4.6-1build1 [23.1 kB]
Get:73 http://ftpmaster.internal/ubuntu noble/main s390x libidn2-0 s390x 2.3.7-2build1 [67.3 kB]
Get:74 http://ftpmaster.internal/ubuntu noble/main s390x libtasn1-6 s390x 4.19.0-3build1 [48.5 kB]
Get:75 http://ftpmaster.internal/ubuntu noble/main s390x libdebconfclient0 s390x 0.271ubuntu3 [11.4 kB]
Get:76 http://ftpmaster.internal/ubuntu noble/main s390x base-passwd s390x 3.6.3build1 [51.5 kB]
Get:77 http://ftpmaster.internal/ubuntu noble/main s390x libassuan0 s390x 2.5.6-1build1 [38.3 kB]
Get:78 http://ftpmaster.internal/ubuntu noble/main s390x libsqlite3-0 s390x 3.45.1-1ubuntu2 [747 kB]
Get:79 http://ftpmaster.internal/ubuntu noble/main s390x gpg s390x 2.4.4-2ubuntu17 [589 kB]
Get:80 http://ftpmaster.internal/ubuntu noble/main s390x libreadline8t64 s390x 8.2-4build1 [171 kB]
Get:81 http://ftpmaster.internal/ubuntu noble/main s390x readline-common all 8.2-4build1 [56.5 kB]
Get:82 http://ftpmaster.internal/ubuntu noble/main s390x libncursesw6 s390x 6.4+20240113-1ubuntu2 [161 kB]
Get:83 http://ftpmaster.internal/ubuntu noble/main s390x libtinfo6 s390x 6.4+20240113-1ubuntu2 [117 kB]
Get:84 http://ftpmaster.internal/ubuntu noble/main s390x gpg-agent s390x 2.4.4-2ubuntu17 [240 kB]
Get:85 http://ftpmaster.internal/ubuntu noble/main s390x gpgconf s390x 2.4.4-2ubuntu17 [111 kB]
Get:86 http://ftpmaster.internal/ubuntu noble/main s390x pinentry-curses s390x 1.2.1-3ubuntu5 [37.6 kB]
Get:87 http://ftpmaster.internal/ubuntu noble/main s390x init-system-helpers all 1.66ubuntu1 [39.4 kB]
Get:88 http://ftpmaster.internal/ubuntu noble/main s390x libnpth0t64 s390x 1.6-3.1build1 [8204 B]
Get:89 http://ftpmaster.internal/ubuntu noble/main s390x gpgv s390x 2.4.4-2ubuntu17 [165 kB]
Get:90 http://ftpmaster.internal/ubuntu noble/main s390x ubuntu-keyring all 2023.11.28.1 [11.1 kB]
Get:91 http://ftpmaster.internal/ubuntu noble/main s390x libseccomp2 s390x 2.5.5-1ubuntu3 [53.4 kB]
Get:92 http://ftpmaster.internal/ubuntu noble/main s390x apt-utils s390x 2.7.14build2 [214 kB]
Get:93 http://ftpmaster.internal/ubuntu noble/main s390x apt s390x 2.7.14build2 [1390 kB]
Get:94 http://ftpmaster.internal/ubuntu noble/main s390x debconf-i18n all 1.5.86ubuntu1 [205 kB]
Get:95 http://ftpmaster.internal/ubuntu noble/main s390x debconf all 1.5.86ubuntu1 [124 kB]
Get:96 http://ftpmaster.internal/ubuntu noble/main s390x libpam0g s390x 1.5.3-5ubuntu5 [69.8 kB]
Get:97 http://ftpmaster.internal/ubuntu noble/main s390x libargon2-1 s390x 0~20190702+dfsg-4build1 [54.1 kB]
Get:98 http://ftpmaster.internal/ubuntu noble/main s390x libdevmapper1.02.1 s390x 2:1.02.185-3ubuntu3 [142 kB]
Get:99 http://ftpmaster.internal/ubuntu noble/main s390x libjson-c5 s390x 0.17-1build1 [37.2 kB]
Get:100 http://ftpmaster.internal/ubuntu noble/main s390x libuuid1 s390x 2.39.3-9ubuntu6 [35.9 kB]
Get:101 http://ftpmaster.internal/ubuntu noble/main s390x libfdisk1 s390x 2.39.3-9ubuntu6 [151 kB]
Get:102 http://ftpmaster.internal/ubuntu noble/main s390x mount s390x 2.39.3-9ubuntu6 [119 kB]
Get:103 http://ftpmaster.internal/ubuntu noble/main s390x libcom-err2 s390x 1.47.0-2.4~exp1ubuntu4 [22.9 kB]
Get:104 http://ftpmaster.internal/ubuntu noble/main s390x libkeyutils1 s390x 1.6.3-3build1 [9556 B]
Get:105 http://ftpmaster.internal/ubuntu noble/main s390x linux-libc-dev s390x 6.8.0-31.31 [1593 kB]
Get:106 http://ftpmaster.internal/ubuntu noble/main s390x base-files s390x 13ubuntu10 [73.7 kB]
Get:107 http://ftpmaster.internal/ubuntu noble/main s390x debianutils s390x 5.17build1 [90.2 kB]
Get:108 http://ftpmaster.internal/ubuntu noble/main s390x bash s390x 5.2.21-2ubuntu4 [845 kB]
Get:109 http://ftpmaster.internal/ubuntu noble/main s390x bsdutils s390x 1:2.39.3-9ubuntu6 [96.5 kB]
Get:110 http://ftpmaster.internal/ubuntu noble/main s390x coreutils s390x 9.4-3ubuntu6 [1483 kB]
Get:111 http://ftpmaster.internal/ubuntu noble/main s390x tar s390x 1.35+dfsg-3build1 [269 kB]
Get:112 http://ftpmaster.internal/ubuntu noble/main s390x dpkg s390x 1.22.6ubuntu6 [1278 kB]
Get:113 http://ftpmaster.internal/ubuntu noble/main s390x dash s390x 0.5.12-6ubuntu5 [95.0 kB]
Get:114 http://ftpmaster.internal/ubuntu noble/main s390x diffutils s390x 1:3.10-1build1 [188 kB]
Get:115 http://ftpmaster.internal/ubuntu noble/main s390x findutils s390x 4.9.0-5build1 [305 kB]
Get:116 http://ftpmaster.internal/ubuntu noble/main s390x grep s390x 3.11-4build1 [173 kB]
Get:117 http://ftpmaster.internal/ubuntu noble/main s390x gzip s390x 1.12-1ubuntu3 [107 kB]
Get:118 http://ftpmaster.internal/ubuntu noble/main s390x hostname s390x 3.23+nmu2ubuntu2 [11.2 kB]
Get:119 http://ftpmaster.internal/ubuntu noble/main s390x login s390x 1:4.13+dfsg1-4ubuntu3 [202 kB]
Get:120 http://ftpmaster.internal/ubuntu noble/main s390x ncurses-bin s390x 6.4+20240113-1ubuntu2 [198 kB]
Get:121 http://ftpmaster.internal/ubuntu noble/main s390x sed s390x 4.9-2build1 [198 kB]
Get:122 http://ftpmaster.internal/ubuntu noble/main s390x util-linux s390x 2.39.3-9ubuntu6 [1142 kB]
Get:123 http://ftpmaster.internal/ubuntu noble/main s390x ncurses-base all 6.4+20240113-1ubuntu2 [25.5 kB]
Get:124 http://ftpmaster.internal/ubuntu noble/main s390x sysvinit-utils s390x 3.08-6ubuntu3 [34.8 kB]
Get:125 http://ftpmaster.internal/ubuntu noble/main s390x logsave s390x 1.47.0-2.4~exp1ubuntu4 [22.6 kB]
Get:126 http://ftpmaster.internal/ubuntu noble/main s390x libext2fs2t64 s390x 1.47.0-2.4~exp1ubuntu4 [234 kB]
Get:127 http://ftpmaster.internal/ubuntu noble/main s390x e2fsprogs s390x 1.47.0-2.4~exp1ubuntu4 [614 kB]
Get:128 http://ftpmaster.internal/ubuntu noble/main s390x optipng s390x 0.7.8+ds-1build2 [114 kB]
Get:129 http://ftpmaster.internal/ubuntu noble/main s390x libpng16-16t64 s390x 1.6.43-5build1 [200 kB]
Get:130 http://ftpmaster.internal/ubuntu noble/main s390x init s390x 1.66ubuntu1 [6188 B]
Get:131 http://ftpmaster.internal/ubuntu noble/main s390x libsmartcols1 s390x 2.39.3-9ubuntu6 [68.2 kB]
Get:132 http://ftpmaster.internal/ubuntu noble/main s390x uuid-runtime s390x 2.39.3-9ubuntu6 [33.4 kB]
Get:133 http://ftpmaster.internal/ubuntu noble/main s390x libattr1 s390x 1:2.5.2-1build1 [11.7 kB]
Get:134 http://ftpmaster.internal/ubuntu noble/main s390x libmd0 s390x 1.1.0-2build1 [24.6 kB]
Get:135 http://ftpmaster.internal/ubuntu noble/main s390x libpam-runtime all 1.5.3-5ubuntu5 [40.8 kB]
Get:136 http://ftpmaster.internal/ubuntu noble/main s390x libsemanage-common all 3.5-1build5 [10.1 kB]
Get:137 http://ftpmaster.internal/ubuntu noble/main s390x libsepol2 s390x 3.5-2build1 [315 kB]
Get:138 http://ftpmaster.internal/ubuntu noble/main s390x libsemanage2 s390x 3.5-1build5 [96.8 kB]
Get:139 http://ftpmaster.internal/ubuntu noble/main s390x passwd s390x 1:4.13+dfsg1-4ubuntu3 [857 kB]
Get:140 http://ftpmaster.internal/ubuntu noble/main s390x libproc2-0 s390x 2:4.0.4-4ubuntu3 [59.8 kB]
Get:141 http://ftpmaster.internal/ubuntu noble/main s390x libss2 s390x 1.47.0-2.4~exp1ubuntu4 [17.2 kB]
Get:142 http://ftpmaster.internal/ubuntu noble/main s390x mawk s390x 1.3.4.20240123-1build1 [133 kB]
Get:143 http://ftpmaster.internal/ubuntu noble/main s390x procps s390x 2:4.0.4-4ubuntu3 [724 kB]
Get:144 http://ftpmaster.internal/ubuntu noble/main s390x sensible-utils all 0.0.22 [22.5 kB]
Get:145 http://ftpmaster.internal/ubuntu noble/main s390x ca-certificates all 20240203 [159 kB]
Get:146 http://ftpmaster.internal/ubuntu noble/main s390x krb5-locales all 1.20.1-6ubuntu2 [13.8 kB]
Get:147 http://ftpmaster.internal/ubuntu noble/main s390x tzdata all 2024a-2ubuntu1 [273 kB]
Get:148 http://ftpmaster.internal/ubuntu noble/main s390x bash-completion all 1:2.11-8 [180 kB]
Get:149 http://ftpmaster.internal/ubuntu noble/main s390x bsdextrautils s390x 2.39.3-9ubuntu6 [76.3 kB]
Get:150 http://ftpmaster.internal/ubuntu noble/main s390x libgpm2 s390x 1.20.7-11 [14.7 kB]
Get:151 http://ftpmaster.internal/ubuntu noble/main s390x libip4tc2 s390x 1.8.10-3ubuntu2 [24.2 kB]
Get:152 http://ftpmaster.internal/ubuntu noble/main s390x libjansson4 s390x 2.14-2build2 [33.2 kB]
Get:153 http://ftpmaster.internal/ubuntu noble/main s390x psmisc s390x 23.7-1build1 [178 kB]
Get:154 http://ftpmaster.internal/ubuntu noble/main s390x xz-utils s390x 5.6.1+really5.4.5-1 [269 kB]
Get:155 http://ftpmaster.internal/ubuntu noble/main s390x advancecomp s390x 2.5-1build1 [205 kB]
Get:156 http://ftpmaster.internal/ubuntu noble/main s390x libctf0 s390x 2.42-4ubuntu2 [98.4 kB]
Get:157 http://ftpmaster.internal/ubuntu noble/main s390x libctf-nobfd0 s390x 2.42-4ubuntu2 [100 kB]
Get:158 http://ftpmaster.internal/ubuntu noble/main s390x binutils-s390x-linux-gnu s390x 2.42-4ubuntu2 [2270 kB]
Get:159 http://ftpmaster.internal/ubuntu noble/main s390x libbinutils s390x 2.42-4ubuntu2 [479 kB]
Get:160 http://ftpmaster.internal/ubuntu noble/main s390x binutils s390x 2.42-4ubuntu2 [3042 B]
Get:161 http://ftpmaster.internal/ubuntu noble/main s390x binutils-common s390x 2.42-4ubuntu2 [217 kB]
Get:162 http://ftpmaster.internal/ubuntu noble/main s390x libsframe1 s390x 2.42-4ubuntu2 [14.2 kB]
Get:163 http://ftpmaster.internal/ubuntu noble/main s390x libisl23 s390x 0.26-3build1 [713 kB]
Get:164 http://ftpmaster.internal/ubuntu noble/main s390x libmpfr6 s390x 4.2.1-1build1 [322 kB]
Get:165 http://ftpmaster.internal/ubuntu noble/main s390x libmpc3 s390x 1.3.1-1build1 [58.4 kB]
Get:166 http://ftpmaster.internal/ubuntu noble/main s390x dpkg-dev all 1.22.6ubuntu6 [1074 kB]
Get:167 http://ftpmaster.internal/ubuntu noble/main s390x libdpkg-perl all 1.22.6ubuntu6 [268 kB]
Get:168 http://ftpmaster.internal/ubuntu noble/main s390x patch s390x 2.7.6-7build3 [113 kB]
Get:169 http://ftpmaster.internal/ubuntu noble/main s390x make s390x 4.3-4.1build2 [196 kB]
Get:170 http://ftpmaster.internal/ubuntu noble/main s390x lto-disabled-list all 47 [12.4 kB]
Get:171 http://ftpmaster.internal/ubuntu noble/main s390x libfakeroot s390x 1.33-1 [31.9 kB]
Get:172 http://ftpmaster.internal/ubuntu noble/main s390x fakeroot s390x 1.33-1 [67.5 kB]
Get:173 http://ftpmaster.internal/ubuntu noble/main s390x liblockfile-bin s390x 1.17-1build3 [11.6 kB]
Get:174 http://ftpmaster.internal/ubuntu noble/main s390x liblockfile1 s390x 1.17-1build3 [7028 B]
Get:175 http://ftpmaster.internal/ubuntu noble/main s390x lockfile-progs s390x 0.1.19build2 [8406 B]
Get:176 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/volatile/ubuntu noble/main s390x g++ s390x 4:14-20240120-6ubuntu1 [1102 B]
Get:177 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/volatile/ubuntu noble/main s390x gcc s390x 4:14-20240120-6ubuntu1 [4996 B]
Get:178 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/volatile/ubuntu noble/main s390x cpp s390x 4:14-20240120-6ubuntu1 [22.5 kB]
Get:179 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/volatile/ubuntu noble/main s390x cpp-s390x-linux-gnu s390x 4:14-20240120-6ubuntu1 [5364 B]
Get:180 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x libcc1-0 s390x 14-20240429-1ubuntu1 [50.0 kB]
Get:181 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x libgomp1 s390x 14-20240429-1ubuntu1 [151 kB]
Get:182 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x libitm1 s390x 14-20240429-1ubuntu1 [31.1 kB]
Get:183 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x libatomic1 s390x 14-20240429-1ubuntu1 [9394 B]
Get:184 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x libasan8 s390x 14-20240429-1ubuntu1 [3004 kB]
Get:185 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x libubsan1 s390x 14-20240429-1ubuntu1 [1189 kB]
Get:186 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x libgcc-14-dev s390x 14-20240429-1ubuntu1 [1041 kB]
Get:187 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x gcc-14-s390x-linux-gnu s390x 14-20240429-1ubuntu1 [97.7 MB]
Get:188 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x libstdc++-14-dev s390x 14-20240429-1ubuntu1 [2585 kB]
Get:189 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x g++-14-s390x-linux-gnu s390x 14-20240429-1ubuntu1 [95.9 MB]
Get:190 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x gcc-14 s390x 14-20240429-1ubuntu1 [478 kB]
Get:191 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x g++-14 s390x 14-20240429-1ubuntu1 [15.4 kB]
Get:192 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/volatile/ubuntu noble/main s390x gcc-s390x-linux-gnu s390x 4:14-20240120-6ubuntu1 [1208 B]
Get:193 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/volatile/ubuntu noble/main s390x g++-s390x-linux-gnu s390x 4:14-20240120-6ubuntu1 [964 B]
Get:194 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x cpp-14 s390x 14-20240429-1ubuntu1 [1032 B]
Get:195 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x g++-13 s390x 13.2.0-24ubuntu1 [15.0 kB]
Get:196 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x gcc-13 s390x 13.2.0-24ubuntu1 [474 kB]
Get:197 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x libstdc++-13-dev s390x 13.2.0-24ubuntu1 [2495 kB]
Get:198 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x libgcc-13-dev s390x 13.2.0-24ubuntu1 [1003 kB]
Get:199 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x cpp-13 s390x 13.2.0-24ubuntu1 [1030 B]
Get:200 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x gcc-13-base s390x 13.2.0-24ubuntu1 [49.3 kB]
Get:201 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x cpp-13-s390x-linux-gnu s390x 13.2.0-24ubuntu1 [9936 kB]
Get:202 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x gcc-13-s390x-linux-gnu s390x 13.2.0-24ubuntu1 [19.1 MB]
Get:203 http://ppa.launchpadcontent.net/ubuntu-toolchain-r/ppa/ubuntu noble/main s390x g++-13-s390x-linux-gnu s390x 13.2.0-24ubuntu1 [11.3 MB]
Preconfiguring packages ...
Fetched 392 MB in 16s (25.1 MB/s)
(Reading database ... 13395 files and directories currently installed.)
Preparing to unpack .../libtirpc-common_1.3.4+ds-1.1build1_all.deb ...
Unpacking libtirpc-common (1.3.4+ds-1.1build1) over (1.3.3+ds-1) ...
Preparing to unpack .../libtirpc-dev_1.3.4+ds-1.1build1_s390x.deb ...
Unpacking libtirpc-dev:s390x (1.3.4+ds-1.1build1) over (1.3.3+ds-1) ...
Preparing to unpack .../libnsl-dev_1.3.0-3build3_s390x.deb ...
Unpacking libnsl-dev:s390x (1.3.0-3build3) over (1.3.0-2build2) ...
Preparing to unpack .../libnsl2_1.3.0-3build3_s390x.deb ...
Unpacking libnsl2:s390x (1.3.0-3build3) over (1.3.0-2build2) ...
dpkg: libtirpc3:s390x: dependency problems, but removing anyway as you requested:
 libnss-nisplus:s390x depends on libtirpc3 (>= 1.0.2).

(Reading database ... 13395 files and directories currently installed.)
Removing libtirpc3:s390x (1.3.3+ds-1) ...
Selecting previously unselected package libtirpc3t64:s390x.
(Reading database ... 13389 files and directories currently installed.)
Preparing to unpack .../0-libtirpc3t64_1.3.4+ds-1.1build1_s390x.deb ...
Adding 'diversion of /lib/s390x-linux-gnu/libtirpc.so.3 to /lib/s390x-linux-gnu/libtirpc.so.3.usr-is-merged by libtirpc3t64'
Adding 'diversion of /lib/s390x-linux-gnu/libtirpc.so.3.0.0 to /lib/s390x-linux-gnu/libtirpc.so.3.0.0.usr-is-merged by libtirpc3t64'
Unpacking libtirpc3t64:s390x (1.3.4+ds-1.1build1) ...
Preparing to unpack .../1-libgssapi-krb5-2_1.20.1-6ubuntu2_s390x.deb ...
Unpacking libgssapi-krb5-2:s390x (1.20.1-6ubuntu2) over (1.20.1-3ubuntu1) ...
Preparing to unpack .../2-libkrb5-3_1.20.1-6ubuntu2_s390x.deb ...
Unpacking libkrb5-3:s390x (1.20.1-6ubuntu2) over (1.20.1-3ubuntu1) ...
Preparing to unpack .../3-libk5crypto3_1.20.1-6ubuntu2_s390x.deb ...
Unpacking libk5crypto3:s390x (1.20.1-6ubuntu2) over (1.20.1-3ubuntu1) ...
Preparing to unpack .../4-libkrb5support0_1.20.1-6ubuntu2_s390x.deb ...
Unpacking libkrb5support0:s390x (1.20.1-6ubuntu2) over (1.20.1-3ubuntu1) ...
Preparing to unpack .../5-libacl1_2.3.2-1build1_s390x.deb ...
Unpacking libacl1:s390x (2.3.2-1build1) over (2.3.1-3) ...
Setting up libacl1:s390x (2.3.2-1build1) ...
(Reading database ... 13400 files and directories currently installed.)
Preparing to unpack .../libapparmor1_4.0.0-beta3-0ubuntu3_s390x.deb ...
Unpacking libapparmor1:s390x (4.0.0-beta3-0ubuntu3) over (4.0.0~alpha2-0ubuntu5) ...
Preparing to unpack .../libaudit-common_1%3a3.1.2-2.1build1_all.deb ...
Unpacking libaudit-common (1:3.1.2-2.1build1) over (1:3.1.1-1) ...
Setting up libaudit-common (1:3.1.2-2.1build1) ...
(Reading database ... 13400 files and directories currently installed.)
Preparing to unpack .../libcap-ng0_0.8.4-2build2_s390x.deb ...
Unpacking libcap-ng0:s390x (0.8.4-2build2) over (0.8.3-1build2) ...
Setting up libcap-ng0:s390x (0.8.4-2build2) ...
(Reading database ... 13400 files and directories currently installed.)
Preparing to unpack .../libaudit1_1%3a3.1.2-2.1build1_s390x.deb ...
Unpacking libaudit1:s390x (1:3.1.2-2.1build1) over (1:3.1.1-1) ...
Setting up libaudit1:s390x (1:3.1.2-2.1build1) ...
(Reading database ... 13400 files and directories currently installed.)
Preparing to unpack .../libblkid1_2.39.3-9ubuntu6_s390x.deb ...
Unpacking libblkid1:s390x (2.39.3-9ubuntu6) over (2.39.1-4ubuntu2) ...
Setting up libblkid1:s390x (2.39.3-9ubuntu6) ...
(Reading database ... 13400 files and directories currently installed.)
Preparing to unpack .../libcap2_1%3a2.66-5ubuntu2_s390x.deb ...
Unpacking libcap2:s390x (1:2.66-5ubuntu2) over (1:2.66-4ubuntu1) ...
Setting up libcap2:s390x (1:2.66-5ubuntu2) ...
(Reading database ... 13400 files and directories currently installed.)
Preparing to unpack .../libcrypt-dev_1%3a4.4.36-4build1_s390x.deb ...
Unpacking libcrypt-dev:s390x (1:4.4.36-4build1) over (1:4.4.36-2) ...
Preparing to unpack .../libcrypt1_1%3a4.4.36-4build1_s390x.deb ...
Unpacking libcrypt1:s390x (1:4.4.36-4build1) over (1:4.4.36-2) ...
Setting up libcrypt1:s390x (1:4.4.36-4build1) ...
(Reading database ... 13400 files and directories currently installed.)
Preparing to unpack .../libgpg-error-l10n_1.47-3build2_all.deb ...
Unpacking libgpg-error-l10n (1.47-3build2) over (1.47-2) ...
Preparing to unpack .../libgpg-error0_1.47-3build2_s390x.deb ...
Unpacking libgpg-error0:s390x (1.47-3build2) over (1.47-2) ...
Setting up libgpg-error0:s390x (1.47-3build2) ...
(Reading database ... 13400 files and directories currently installed.)
Preparing to unpack .../libgcrypt20_1.10.3-2build1_s390x.deb ...
Unpacking libgcrypt20:s390x (1.10.3-2build1) over (1.10.2-3ubuntu1) ...
Setting up libgcrypt20:s390x (1.10.3-2build1) ...
(Reading database ... 13400 files and directories currently installed.)
Preparing to unpack .../liblzma5_5.6.1+really5.4.5-1_s390x.deb ...
Unpacking liblzma5:s390x (5.6.1+really5.4.5-1) over (5.4.1-0.2) ...
Setting up liblzma5:s390x (5.6.1+really5.4.5-1) ...
(Reading database ... 13400 files and directories currently installed.)
Preparing to unpack .../libzstd1_1.5.5+dfsg2-2build1_s390x.deb ...
Unpacking libzstd1:s390x (1.5.5+dfsg2-2build1) over (1.5.5+dfsg2-1ubuntu2) ...
Setting up libzstd1:s390x (1.5.5+dfsg2-2build1) ...
(Reading database ... 13400 files and directories currently installed.)
Preparing to unpack .../libkmod2_31+20240202-2ubuntu7_s390x.deb ...
Unpacking libkmod2:s390x (31+20240202-2ubuntu7) over (30+20230519-1ubuntu3) ...
Preparing to unpack .../liblz4-1_1.9.4-1build1_s390x.deb ...
Unpacking liblz4-1:s390x (1.9.4-1build1) over (1.9.4-1) ...
Setting up liblz4-1:s390x (1.9.4-1build1) ...
(Reading database ... 13400 files and directories currently installed.)
Preparing to unpack .../libpcre2-8-0_10.42-4ubuntu2_s390x.deb ...
Unpacking libpcre2-8-0:s390x (10.42-4ubuntu2) over (10.42-4) ...
Setting up libpcre2-8-0:s390x (10.42-4ubuntu2) ...
(Reading database ... 13400 files and directories currently installed.)
Preparing to unpack .../libselinux1_3.5-2ubuntu2_s390x.deb ...
Unpacking libselinux1:s390x (3.5-2ubuntu2) over (3.5-1) ...
Setting up libselinux1:s390x (3.5-2ubuntu2) ...
(Reading database ... 13401 files and directories currently installed.)
Preparing to unpack .../libmount1_2.39.3-9ubuntu6_s390x.deb ...
Unpacking libmount1:s390x (2.39.3-9ubuntu6) over (2.39.1-4ubuntu2) ...
Setting up libmount1:s390x (2.39.3-9ubuntu6) ...
(Reading database ... 13401 files and directories currently installed.)
Preparing to unpack .../perl_5.38.2-3.2build2_s390x.deb ...
Unpacking perl (5.38.2-3.2build2) over (5.36.0-9ubuntu1) ...
Selecting previously unselected package perl-modules-5.38.
Preparing to unpack .../perl-modules-5.38_5.38.2-3.2build2_all.deb ...
Unpacking perl-modules-5.38 (5.38.2-3.2build2) ...
dpkg: libdb5.3:s390x: dependency problems, but removing anyway as you requested:
 libperl5.36:s390x depends on libdb5.3.
 libpam-modules:s390x depends on libdb5.3.
 apt-utils depends on libdb5.3.

(Reading database ... 14813 files and directories currently installed.)
Removing libdb5.3:s390x (5.3.28+dfsg2-2) ...
Selecting previously unselected package libdb5.3t64:s390x.
(Reading database ... 14807 files and directories currently installed.)
Preparing to unpack .../libdb5.3t64_5.3.28+dfsg2-7_s390x.deb ...
Unpacking libdb5.3t64:s390x (5.3.28+dfsg2-7) ...
dpkg: libgdbm6:s390x: dependency problems, but removing anyway as you requested:
 libperl5.36:s390x depends on libgdbm6 (>= 1.21).
 libgdbm-compat4:s390x depends on libgdbm6 (>= 1.16).

(Reading database ... 14813 files and directories currently installed.)
Removing libgdbm6:s390x (1.23-3) ...
Selecting previously unselected package libgdbm6t64:s390x.
(Reading database ... 14808 files and directories currently installed.)
Preparing to unpack .../libgdbm6t64_1.23-5.1build1_s390x.deb ...
Unpacking libgdbm6t64:s390x (1.23-5.1build1) ...
dpkg: libgdbm-compat4:s390x: dependency problems, but removing anyway as you requested:
 libperl5.36:s390x depends on libgdbm-compat4 (>= 1.18-3).

(Reading database ... 14814 files and directories currently installed.)
Removing libgdbm-compat4:s390x (1.23-3) ...
Selecting previously unselected package libgdbm-compat4t64:s390x.
(Reading database ... 14809 files and directories currently installed.)
Preparing to unpack .../libgdbm-compat4t64_1.23-5.1build1_s390x.deb ...
Unpacking libgdbm-compat4t64:s390x (1.23-5.1build1) ...
Selecting previously unselected package libperl5.38t64:s390x.
Preparing to unpack .../libperl5.38t64_5.38.2-3.2build2_s390x.deb ...
Unpacking libperl5.38t64:s390x (5.38.2-3.2build2) ...
Preparing to unpack .../perl-base_5.38.2-3.2build2_s390x.deb ...
Unpacking perl-base (5.38.2-3.2build2) over (5.36.0-9ubuntu1) ...
Setting up perl-base (5.38.2-3.2build2) ...
(Reading database ... 15340 files and directories currently installed.)
Preparing to unpack .../0-liblocale-gettext-perl_1.07-6ubuntu5_s390x.deb ...
Unpacking liblocale-gettext-perl (1.07-6ubuntu5) over (1.07-6) ...
Preparing to unpack .../1-libtext-iconv-perl_1.7-8build3_s390x.deb ...
Unpacking libtext-iconv-perl:s390x (1.7-8build3) over (1.7-8) ...
Preparing to unpack .../2-libtext-charwidth-perl_0.04-11build3_s390x.deb ...
Unpacking libtext-charwidth-perl:s390x (0.04-11build3) over (0.04-11) ...
Preparing to unpack .../3-libnss-nisplus_1.3-5build1_s390x.deb ...
Unpacking libnss-nisplus:s390x (1.3-5build1) over (1.3-0ubuntu6) ...
Preparing to unpack .../4-libnss-nis_3.1-0ubuntu7_s390x.deb ...
Unpacking libnss-nis:s390x (3.1-0ubuntu7) over (3.1-0ubuntu6) ...
Preparing to unpack .../5-libc-dev-bin_2.39-0ubuntu8_s390x.deb ...
Unpacking libc-dev-bin (2.39-0ubuntu8) over (2.38-1ubuntu6) ...
Preparing to unpack .../6-rpcsvc-proto_1.4.2-0ubuntu7_s390x.deb ...
Unpacking rpcsvc-proto (1.4.2-0ubuntu7) over (1.4.2-0ubuntu6) ...
Preparing to unpack .../7-libc6-dev_2.39-0ubuntu8_s390x.deb ...
Unpacking libc6-dev:s390x (2.39-0ubuntu8) over (2.38-1ubuntu6) ...
Preparing to unpack .../8-libc6_2.39-0ubuntu8_s390x.deb ...
Unpacking libc6:s390x (2.39-0ubuntu8) over (2.38-1ubuntu6) ...
Setting up libc6:s390x (2.39-0ubuntu8) ...
(Reading database ... 15345 files and directories currently installed.)
Preparing to unpack .../libc-bin_2.39-0ubuntu8_s390x.deb ...
Unpacking libc-bin (2.39-0ubuntu8) over (2.38-1ubuntu6) ...
Setting up libc-bin (2.39-0ubuntu8) ...
(Reading database ... 15345 files and directories currently installed.)
Preparing to unpack .../openssl_3.0.13-0ubuntu3_s390x.deb ...
Unpacking openssl (3.0.13-0ubuntu3) over (3.0.10-1ubuntu2) ...
Preparing to unpack .../libsystemd-shared_255.4-1ubuntu8_s390x.deb ...
Unpacking libsystemd-shared:s390x (255.4-1ubuntu8) over (253.5-1ubuntu6) ...
Preparing to unpack .../libcryptsetup12_2%3a2.7.0-1ubuntu4_s390x.deb ...
Unpacking libcryptsetup12:s390x (2:2.7.0-1ubuntu4) over (2:2.6.1-4ubuntu3) ...
dpkg: libssl3:s390x: dependency problems, but removing anyway as you requested:
 systemd depends on libssl3 (>= 3.0.0).

(Reading database ... 15344 files and directories currently installed.)
Removing libssl3:s390x (3.0.10-1ubuntu2) ...
Selecting previously unselected package libssl3t64:s390x.
(Reading database ... 15333 files and directories currently installed.)
Preparing to unpack .../libssl3t64_3.0.13-0ubuntu3_s390x.deb ...
Unpacking libssl3t64:s390x (3.0.13-0ubuntu3) ...
Setting up libssl3t64:s390x (3.0.13-0ubuntu3) ...
(Reading database ... 15346 files and directories currently installed.)
Preparing to unpack .../systemd-dev_255.4-1ubuntu8_all.deb ...
Unpacking systemd-dev (255.4-1ubuntu8) over (253.5-1ubuntu6) ...
Preparing to unpack .../systemd-sysv_255.4-1ubuntu8_s390x.deb ...
Unpacking systemd-sysv (255.4-1ubuntu8) over (253.5-1ubuntu6) ...
Preparing to unpack .../systemd_255.4-1ubuntu8_s390x.deb ...
Unpacking systemd (255.4-1ubuntu8) over (253.5-1ubuntu6) ...
dpkg: warning: unable to delete old directory '/lib/systemd/system-preset': Directory not empty
dpkg: warning: unable to delete old directory '/lib/systemd/system-generators': Directory not empty
dpkg: warning: unable to delete old directory '/lib/systemd/system/user@0.service.d': Directory not empty
dpkg: warning: unable to delete old directory '/lib/systemd/system/user@.service.d': Directory not empty
dpkg: warning: unable to delete old directory '/lib/systemd/system/user-.slice.d': Directory not empty
dpkg: warning: unable to delete old directory '/lib/systemd/system/timers.target.wants': Directory not empty
dpkg: warning: unable to delete old directory '/lib/systemd/system/systemd-localed.service.d': Directory not empty
dpkg: warning: unable to delete old directory '/lib/systemd/system/sysinit.target.wants': Directory not empty
dpkg: warning: unable to delete old directory '/lib/systemd/system/sockets.target.wants': Directory not empty
dpkg: warning: unable to delete old directory '/lib/systemd/system/rescue.target.wants': Directory not empty
dpkg: warning: unable to delete old directory '/lib/systemd/system/rc-local.service.d': Directory not empty
dpkg: warning: unable to delete old directory '/lib/systemd/system/multi-user.target.wants': Directory not empty
dpkg: warning: unable to delete old directory '/lib/systemd/system/initrd-root-fs.target.wants': Directory not empty
dpkg: warning: unable to delete old directory '/lib/systemd/system/initrd-root-device.target.wants': Directory not empty
dpkg: warning: unable to delete old directory '/lib/systemd/system/graphical.target.wants': Directory not empty
dpkg: warning: unable to delete old directory '/lib/systemd/system/getty.target.wants': Directory not empty
dpkg: warning: unable to delete old directory '/lib/systemd/network': Directory not empty
dpkg: warning: unable to delete old directory '/lib/systemd/journald.conf.d': Directory not empty
dpkg: warning: unable to delete old directory '/lib/modprobe.d': Directory not empty
Preparing to unpack .../libsystemd0_255.4-1ubuntu8_s390x.deb ...
Unpacking libsystemd0:s390x (255.4-1ubuntu8) over (253.5-1ubuntu6) ...
Setting up libsystemd0:s390x (255.4-1ubuntu8) ...
(Reading database ... 15485 files and directories currently installed.)
Preparing to unpack .../libpam-modules-bin_1.5.3-5ubuntu5_s390x.deb ...
Unpacking libpam-modules-bin (1.5.3-5ubuntu5) over (1.5.2-6ubuntu1) ...
Setting up libpam-modules-bin (1.5.3-5ubuntu5) ...
(Reading database ... 15484 files and directories currently installed.)
Preparing to unpack .../libpam-modules_1.5.3-5ubuntu5_s390x.deb ...
Unpacking libpam-modules:s390x (1.5.3-5ubuntu5) over (1.5.2-6ubuntu1) ...
dpkg: warning: unable to delete old directory '/lib/s390x-linux-gnu/security': Directory not empty
Setting up libpam-modules:s390x (1.5.3-5ubuntu5) ...
Installing new version of config file /etc/security/namespace.init ...
dpkg: libhogweed6:s390x: dependency problems, but removing anyway as you requested:
 libgnutls30:s390x depends on libhogweed6 (>= 3.6).

(Reading database ... 15481 files and directories currently installed.)
Removing libhogweed6:s390x (3.9.1-2) ...
dpkg: libnettle8:s390x: dependency problems, but removing anyway as you requested:
 libgnutls30:s390x depends on libnettle8 (>= 3.7~).

Removing libnettle8:s390x (3.9.1-2) ...
Selecting previously unselected package libnettle8t64:s390x.
(Reading database ... 15469 files and directories currently installed.)
Preparing to unpack .../libnettle8t64_3.9.1-2.2build1_s390x.deb ...
Unpacking libnettle8t64:s390x (3.9.1-2.2build1) ...
Setting up libnettle8t64:s390x (3.9.1-2.2build1) ...
Selecting previously unselected package libhogweed6t64:s390x.
(Reading database ... 15477 files and directories currently installed.)
Preparing to unpack .../libhogweed6t64_3.9.1-2.2build1_s390x.deb ...
Unpacking libhogweed6t64:s390x (3.9.1-2.2build1) ...
Setting up libhogweed6t64:s390x (3.9.1-2.2build1) ...
(Reading database ... 15483 files and directories currently installed.)
Preparing to unpack .../libp11-kit0_0.25.3-4ubuntu2_s390x.deb ...
Unpacking libp11-kit0:s390x (0.25.3-4ubuntu2) over (0.25.0-4ubuntu1) ...
Setting up libp11-kit0:s390x (0.25.3-4ubuntu2) ...
Selecting previously unselected package libunistring5:s390x.
(Reading database ... 15483 files and directories currently installed.)
Preparing to unpack .../libunistring5_1.1-2build1_s390x.deb ...
Unpacking libunistring5:s390x (1.1-2build1) ...
Setting up libunistring5:s390x (1.1-2build1) ...
dpkg: libgnutls30:s390x: dependency problems, but removing anyway as you requested:
 apt depends on libgnutls30 (>= 3.7.5).

(Reading database ... 15488 files and directories currently installed.)
Removing libgnutls30:s390x (3.8.1-4ubuntu1) ...
Selecting previously unselected package libgnutls30t64:s390x.
(Reading database ... 15478 files and directories currently installed.)
Preparing to unpack .../libgnutls30t64_3.8.3-1.1ubuntu3_s390x.deb ...
Unpacking libgnutls30t64:s390x (3.8.3-1.1ubuntu3) ...
Setting up libgnutls30t64:s390x (3.8.3-1.1ubuntu3) ...
dpkg: libapt-pkg6.0:s390x: dependency problems, but removing anyway as you requested:
 apt-utils depends on libapt-pkg6.0 (>= 2.7.3).
 apt depends on libapt-pkg6.0 (>= 2.7.3).

(Reading database ... 15490 files and directories currently installed.)
Removing libapt-pkg6.0:s390x (2.7.3) ...
Selecting previously unselected package libapt-pkg6.0t64:s390x.
(Reading database ... 15441 files and directories currently installed.)
Preparing to unpack .../libapt-pkg6.0t64_2.7.14build2_s390x.deb ...
Unpacking libapt-pkg6.0t64:s390x (2.7.14build2) ...
Setting up libapt-pkg6.0t64:s390x (2.7.14build2) ...
(Reading database ... 15491 files and directories currently installed.)
Preparing to unpack .../bzip2_1.0.8-5.1_s390x.deb ...
Unpacking bzip2 (1.0.8-5.1) over (1.0.8-5build1) ...
dpkg: warning: old file '/bin/bzip2' is the same as several new files! (both '/usr/bin/bunzip2' and '/usr/bin/bzcat')
dpkg: warning: old file '/bin/bzip2' is the same as several new files! (both '/usr/bin/bzcat' and '/usr/bin/bzip2')
dpkg: warning: old file '/bin/bzcat' is the same as several new files! (both '/usr/bin/bunzip2' and '/usr/bin/bzcat')
dpkg: warning: old file '/bin/bzcat' is the same as several new files! (both '/usr/bin/bzcat' and '/usr/bin/bzip2')
dpkg: warning: old file '/bin/bunzip2' is the same as several new files! (both '/usr/bin/bunzip2' and '/usr/bin/bzcat')
dpkg: warning: old file '/bin/bunzip2' is the same as several new files! (both '/usr/bin/bzcat' and '/usr/bin/bzip2')
Preparing to unpack .../libbz2-1.0_1.0.8-5.1_s390x.deb ...
Unpacking libbz2-1.0:s390x (1.0.8-5.1) over (1.0.8-5build1) ...
Setting up libbz2-1.0:s390x (1.0.8-5.1) ...
Selecting previously unselected package gcc-14-base:s390x.
(Reading database ... 15491 files and directories currently installed.)
Preparing to unpack .../gcc-14-base_14-20240429-1ubuntu1_s390x.deb ...
Unpacking gcc-14-base:s390x (14-20240429-1ubuntu1) ...
Setting up gcc-14-base:s390x (14-20240429-1ubuntu1) ...
(Reading database ... 15496 files and directories currently installed.)
Preparing to unpack .../libgcc-s1_14-20240429-1ubuntu1_s390x.deb ...
Unpacking libgcc-s1:s390x (14-20240429-1ubuntu1) over (13.2.0-4ubuntu3) ...
Setting up libgcc-s1:s390x (14-20240429-1ubuntu1) ...
(Reading database ... 15496 files and directories currently installed.)
Preparing to unpack .../libstdc++6_14-20240429-1ubuntu1_s390x.deb ...
Unpacking libstdc++6:s390x (14-20240429-1ubuntu1) over (13.2.0-4ubuntu3) ...
Setting up libstdc++6:s390x (14-20240429-1ubuntu1) ...
(Reading database ... 15496 files and directories currently installed.)
Preparing to unpack .../libudev1_255.4-1ubuntu8_s390x.deb ...
Unpacking libudev1:s390x (255.4-1ubuntu8) over (253.5-1ubuntu6) ...
Setting up libudev1:s390x (255.4-1ubuntu8) ...
(Reading database ... 15496 files and directories currently installed.)
Preparing to unpack .../libxxhash0_0.8.2-2build1_s390x.deb ...
Unpacking libxxhash0:s390x (0.8.2-2build1) over (0.8.1-1) ...
Setting up libxxhash0:s390x (0.8.2-2build1) ...
(Reading database ... 15496 files and directories currently installed.)
Preparing to unpack .../zlib1g_1%3a1.3.dfsg-3.1ubuntu2_s390x.deb ...
Unpacking zlib1g:s390x (1:1.3.dfsg-3.1ubuntu2) over (1:1.2.13.dfsg-1ubuntu5) ...
Setting up zlib1g:s390x (1:1.3.dfsg-3.1ubuntu2) ...
(Reading database ... 15496 files and directories currently installed.)
Preparing to unpack .../libgmp10_2%3a6.3.0+dfsg-2ubuntu6_s390x.deb ...
Unpacking libgmp10:s390x (2:6.3.0+dfsg-2ubuntu6) over (2:6.3.0+dfsg-2ubuntu4) ...
Setting up libgmp10:s390x (2:6.3.0+dfsg-2ubuntu6) ...
(Reading database ... 15496 files and directories currently installed.)
Preparing to unpack .../libffi8_3.4.6-1build1_s390x.deb ...
Unpacking libffi8:s390x (3.4.6-1build1) over (3.4.4-1) ...
Setting up libffi8:s390x (3.4.6-1build1) ...
(Reading database ... 15496 files and directories currently installed.)
Preparing to unpack .../libidn2-0_2.3.7-2build1_s390x.deb ...
Unpacking libidn2-0:s390x (2.3.7-2build1) over (2.3.4-1) ...
Setting up libidn2-0:s390x (2.3.7-2build1) ...
(Reading database ... 15496 files and directories currently installed.)
Preparing to unpack .../libtasn1-6_4.19.0-3build1_s390x.deb ...
Unpacking libtasn1-6:s390x (4.19.0-3build1) over (4.19.0-3) ...
Setting up libtasn1-6:s390x (4.19.0-3build1) ...
(Reading database ... 15496 files and directories currently installed.)
Preparing to unpack .../libdebconfclient0_0.271ubuntu3_s390x.deb ...
Unpacking libdebconfclient0:s390x (0.271ubuntu3) over (0.270ubuntu1) ...
Setting up libdebconfclient0:s390x (0.271ubuntu3) ...
(Reading database ... 15496 files and directories currently installed.)
Preparing to unpack .../base-passwd_3.6.3build1_s390x.deb ...
Unpacking base-passwd (3.6.3build1) over (3.6.1) ...
Setting up base-passwd (3.6.3build1) ...
(Reading database ... 15496 files and directories currently installed.)
Preparing to unpack .../libassuan0_2.5.6-1build1_s390x.deb ...
Unpacking libassuan0:s390x (2.5.6-1build1) over (2.5.6-1) ...
Setting up libassuan0:s390x (2.5.6-1build1) ...
(Reading database ... 15496 files and directories currently installed.)
Preparing to unpack .../libsqlite3-0_3.45.1-1ubuntu2_s390x.deb ...
Unpacking libsqlite3-0:s390x (3.45.1-1ubuntu2) over (3.42.0-1) ...
Preparing to unpack .../gpg_2.4.4-2ubuntu17_s390x.deb ...
Unpacking gpg (2.4.4-2ubuntu17) over (2.2.40-1.1ubuntu1) ...
dpkg: libreadline8:s390x: dependency problems, but removing anyway as you requested:
 gpgconf depends on libreadline8 (>= 6.0).

(Reading database ... 15496 files and directories currently installed.)
Removing libreadline8:s390x (8.2-1.3) ...
Selecting previously unselected package libreadline8t64:s390x.
(Reading database ... 15484 files and directories currently installed.)
Preparing to unpack .../libreadline8t64_8.2-4build1_s390x.deb ...
Adding 'diversion of /lib/s390x-linux-gnu/libhistory.so.8 to /lib/s390x-linux-gnu/libhistory.so.8.usr-is-merged by libreadline8t64'
Adding 'diversion of /lib/s390x-linux-gnu/libhistory.so.8.2 to /lib/s390x-linux-gnu/libhistory.so.8.2.usr-is-merged by libreadline8t64'
Adding 'diversion of /lib/s390x-linux-gnu/libreadline.so.8 to /lib/s390x-linux-gnu/libreadline.so.8.usr-is-merged by libreadline8t64'
Adding 'diversion of /lib/s390x-linux-gnu/libreadline.so.8.2 to /lib/s390x-linux-gnu/libreadline.so.8.2.usr-is-merged by libreadline8t64'
Unpacking libreadline8t64:s390x (8.2-4build1) ...
Preparing to unpack .../readline-common_8.2-4build1_all.deb ...
Unpacking readline-common (8.2-4build1) over (8.2-1.3) ...
Preparing to unpack .../libncursesw6_6.4+20240113-1ubuntu2_s390x.deb ...
Unpacking libncursesw6:s390x (6.4+20240113-1ubuntu2) over (6.4+20230625-2) ...
Preparing to unpack .../libtinfo6_6.4+20240113-1ubuntu2_s390x.deb ...
Unpacking libtinfo6:s390x (6.4+20240113-1ubuntu2) over (6.4+20230625-2) ...
Setting up libtinfo6:s390x (6.4+20240113-1ubuntu2) ...
(Reading database ... 15504 files and directories currently installed.)
Preparing to unpack .../gpg-agent_2.4.4-2ubuntu17_s390x.deb ...
Unpacking gpg-agent (2.4.4-2ubuntu17) over (2.2.40-1.1ubuntu1) ...
Preparing to unpack .../gpgconf_2.4.4-2ubuntu17_s390x.deb ...
Unpacking gpgconf (2.4.4-2ubuntu17) over (2.2.40-1.1ubuntu1) ...
Preparing to unpack .../pinentry-curses_1.2.1-3ubuntu5_s390x.deb ...
Unpacking pinentry-curses (1.2.1-3ubuntu5) over (1.2.1-1ubuntu1) ...
Preparing to unpack .../init-system-helpers_1.66ubuntu1_all.deb ...
Unpacking init-system-helpers (1.66ubuntu1) over (1.65.2ubuntu1) ...
Setting up init-system-helpers (1.66ubuntu1) ...
(Reading database ... 15503 files and directories currently installed.)
Removing libnpth0:s390x (1.6-3build2) ...
Selecting previously unselected package libnpth0t64:s390x.
(Reading database ... 15498 files and directories currently installed.)
Preparing to unpack .../libnpth0t64_1.6-3.1build1_s390x.deb ...
Unpacking libnpth0t64:s390x (1.6-3.1build1) ...
Setting up libnpth0t64:s390x (1.6-3.1build1) ...
(Reading database ... 15504 files and directories currently installed.)
Preparing to unpack .../gpgv_2.4.4-2ubuntu17_s390x.deb ...
Unpacking gpgv (2.4.4-2ubuntu17) over (2.2.40-1.1ubuntu1) ...
Setting up gpgv (2.4.4-2ubuntu17) ...
(Reading database ... 15504 files and directories currently installed.)
Preparing to unpack .../ubuntu-keyring_2023.11.28.1_all.deb ...
Unpacking ubuntu-keyring (2023.11.28.1) over (2021.03.26) ...
Setting up ubuntu-keyring (2023.11.28.1) ...
(Reading database ... 15504 files and directories currently installed.)
Preparing to unpack .../libseccomp2_2.5.5-1ubuntu3_s390x.deb ...
Unpacking libseccomp2:s390x (2.5.5-1ubuntu3) over (2.5.4-1ubuntu3) ...
Setting up libseccomp2:s390x (2.5.5-1ubuntu3) ...
(Reading database ... 15504 files and directories currently installed.)
Preparing to unpack .../apt-utils_2.7.14build2_s390x.deb ...
Unpacking apt-utils (2.7.14build2) over (2.7.3) ...
Preparing to unpack .../apt_2.7.14build2_s390x.deb ...
Unpacking apt (2.7.14build2) over (2.7.3) ...
Setting up apt (2.7.14build2) ...
(Reading database ... 15504 files and directories currently installed.)
Preparing to unpack .../debconf-i18n_1.5.86ubuntu1_all.deb ...
Unpacking debconf-i18n (1.5.86ubuntu1) over (1.5.82) ...
Preparing to unpack .../debconf_1.5.86ubuntu1_all.deb ...
Unpacking debconf (1.5.86ubuntu1) over (1.5.82) ...
Setting up debconf (1.5.86ubuntu1) ...
Installing new version of config file /etc/debconf.conf ...
(Reading database ... 15503 files and directories currently installed.)
Preparing to unpack .../libpam0g_1.5.3-5ubuntu5_s390x.deb ...
Unpacking libpam0g:s390x (1.5.3-5ubuntu5) over (1.5.2-6ubuntu1) ...
Setting up libpam0g:s390x (1.5.3-5ubuntu5) ...
(Reading database ... 15502 files and directories currently installed.)
Preparing to unpack .../libargon2-1_0~20190702+dfsg-4build1_s390x.deb ...
Unpacking libargon2-1:s390x (0~20190702+dfsg-4build1) over (0~20190702+dfsg-3) ...
Preparing to unpack .../libdevmapper1.02.1_2%3a1.02.185-3ubuntu3_s390x.deb ...
Unpacking libdevmapper1.02.1:s390x (2:1.02.185-3ubuntu3) over (2:1.02.185-2ubuntu1) ...
Preparing to unpack .../libjson-c5_0.17-1build1_s390x.deb ...
Unpacking libjson-c5:s390x (0.17-1build1) over (0.17-1) ...
Preparing to unpack .../libuuid1_2.39.3-9ubuntu6_s390x.deb ...
Unpacking libuuid1:s390x (2.39.3-9ubuntu6) over (2.39.1-4ubuntu2) ...
Setting up libuuid1:s390x (2.39.3-9ubuntu6) ...
(Reading database ... 15502 files and directories currently installed.)
Preparing to unpack .../0-libfdisk1_2.39.3-9ubuntu6_s390x.deb ...
Unpacking libfdisk1:s390x (2.39.3-9ubuntu6) over (2.39.1-4ubuntu2) ...
Preparing to unpack .../1-mount_2.39.3-9ubuntu6_s390x.deb ...
Unpacking mount (2.39.3-9ubuntu6) over (2.39.1-4ubuntu2) ...
Preparing to unpack .../2-libcom-err2_1.47.0-2.4~exp1ubuntu4_s390x.deb ...
Unpacking libcom-err2:s390x (1.47.0-2.4~exp1ubuntu4) over (1.47.0-2ubuntu1) ...
Preparing to unpack .../3-libkeyutils1_1.6.3-3build1_s390x.deb ...
Unpacking libkeyutils1:s390x (1.6.3-3build1) over (1.6.3-2) ...
Preparing to unpack .../4-linux-libc-dev_6.8.0-31.31_s390x.deb ...
Unpacking linux-libc-dev:s390x (6.8.0-31.31) over (6.5.0-9.9) ...
Preparing to unpack .../5-base-files_13ubuntu10_s390x.deb ...
Unpacking base-files (13ubuntu10) over (13ubuntu3) ...
Setting up base-files (13ubuntu10) ...
Installing new version of config file /etc/issue ...
Installing new version of config file /etc/issue.net ...
Installing new version of config file /etc/lsb-release ...
Installing new version of config file /etc/update-motd.d/10-help-text ...
(Reading database ... 15521 files and directories currently installed.)
Preparing to unpack .../debianutils_5.17build1_s390x.deb ...
Unpacking debianutils (5.17build1) over (5.8-1) ...
Setting up debianutils (5.17build1) ...
(Reading database ... 15520 files and directories currently installed.)
Preparing to unpack .../bash_5.2.21-2ubuntu4_s390x.deb ...
Unpacking bash (5.2.21-2ubuntu4) over (5.2.15-2ubuntu1) ...
Setting up bash (5.2.21-2ubuntu4) ...
update-alternatives: using /usr/share/man/man7/bash-builtins.7.gz to provide /usr/share/man/man7/builtins.7.gz (builtins.7.gz) in auto mode
(Reading database ... 15520 files and directories currently installed.)
Preparing to unpack .../bsdutils_1%3a2.39.3-9ubuntu6_s390x.deb ...
Unpacking bsdutils (1:2.39.3-9ubuntu6) over (1:2.39.1-4ubuntu2) ...
Setting up bsdutils (1:2.39.3-9ubuntu6) ...
(Reading database ... 15520 files and directories currently installed.)
Removing usrmerge (35ubuntu1) ...
(Reading database ... 15494 files and directories currently installed.)
Preparing to unpack .../coreutils_9.4-3ubuntu6_s390x.deb ...
Unpacking coreutils (9.4-3ubuntu6) over (9.1-1ubuntu2) ...
Setting up coreutils (9.4-3ubuntu6) ...
(Reading database ... 15499 files and directories currently installed.)
Preparing to unpack .../tar_1.35+dfsg-3build1_s390x.deb ...
Unpacking tar (1.35+dfsg-3build1) over (1.34+dfsg-1.2ubuntu1) ...
Setting up tar (1.35+dfsg-3build1) ...
(Reading database ... 15499 files and directories currently installed.)
Preparing to unpack .../dpkg_1.22.6ubuntu6_s390x.deb ...
Unpacking dpkg (1.22.6ubuntu6) over (1.22.0ubuntu1) ...
Setting up dpkg (1.22.6ubuntu6) ...
(Reading database ... 15497 files and directories currently installed.)
Preparing to unpack .../dash_0.5.12-6ubuntu5_s390x.deb ...
Unpacking dash (0.5.12-6ubuntu5) over (0.5.12-6ubuntu1) ...
Setting up dash (0.5.12-6ubuntu5) ...
(Reading database ... 15496 files and directories currently installed.)
Preparing to unpack .../diffutils_1%3a3.10-1build1_s390x.deb ...
Unpacking diffutils (1:3.10-1build1) over (1:3.8-4) ...
Setting up diffutils (1:3.10-1build1) ...
(Reading database ... 15496 files and directories currently installed.)
Preparing to unpack .../findutils_4.9.0-5build1_s390x.deb ...
Unpacking findutils (4.9.0-5build1) over (4.9.0-5) ...
Setting up findutils (4.9.0-5build1) ...
(Reading database ... 15495 files and directories currently installed.)
Preparing to unpack .../grep_3.11-4build1_s390x.deb ...
Unpacking grep (3.11-4build1) over (3.11-2) ...
Setting up grep (3.11-4build1) ...
(Reading database ... 15495 files and directories currently installed.)
Preparing to unpack .../gzip_1.12-1ubuntu3_s390x.deb ...
Unpacking gzip (1.12-1ubuntu3) over (1.12-1ubuntu1) ...
dpkg: warning: old file '/bin/uncompress' is the same as several new files! (both '/usr/bin/gunzip' and '/usr/bin/uncompress')
dpkg: warning: old file '/bin/gunzip' is the same as several new files! (both '/usr/bin/gunzip' and '/usr/bin/uncompress')
Setting up gzip (1.12-1ubuntu3) ...
(Reading database ... 15495 files and directories currently installed.)
Preparing to unpack .../hostname_3.23+nmu2ubuntu2_s390x.deb ...
Unpacking hostname (3.23+nmu2ubuntu2) over (3.23+nmu1ubuntu1) ...
Setting up hostname (3.23+nmu2ubuntu2) ...
(Reading database ... 15495 files and directories currently installed.)
Preparing to unpack .../login_1%3a4.13+dfsg1-4ubuntu3_s390x.deb ...
Unpacking login (1:4.13+dfsg1-4ubuntu3) over (1:4.13+dfsg1-1ubuntu1) ...
Setting up login (1:4.13+dfsg1-4ubuntu3) ...
Installing new version of config file /etc/login.defs ...
Installing new version of config file /etc/pam.d/login ...
(Reading database ... 15495 files and directories currently installed.)
Preparing to unpack .../ncurses-bin_6.4+20240113-1ubuntu2_s390x.deb ...
Unpacking ncurses-bin (6.4+20240113-1ubuntu2) over (6.4+20230625-2) ...
Setting up ncurses-bin (6.4+20240113-1ubuntu2) ...
(Reading database ... 15495 files and directories currently installed.)
Preparing to unpack .../sed_4.9-2build1_s390x.deb ...
Unpacking sed (4.9-2build1) over (4.9-1) ...
Setting up sed (4.9-2build1) ...
(Reading database ... 15495 files and directories currently installed.)
Preparing to unpack .../util-linux_2.39.3-9ubuntu6_s390x.deb ...
Unpacking util-linux (2.39.3-9ubuntu6) over (2.39.1-4ubuntu2) ...
Setting up util-linux (2.39.3-9ubuntu6) ...
(Reading database ... 15497 files and directories currently installed.)
Preparing to unpack .../ncurses-base_6.4+20240113-1ubuntu2_all.deb ...
Unpacking ncurses-base (6.4+20240113-1ubuntu2) over (6.4+20230625-2) ...
Setting up ncurses-base (6.4+20240113-1ubuntu2) ...
(Reading database ... 15497 files and directories currently installed.)
Preparing to unpack .../sysvinit-utils_3.08-6ubuntu3_s390x.deb ...
Unpacking sysvinit-utils (3.08-6ubuntu3) over (3.07-1ubuntu1) ...
dpkg: warning: unable to delete old directory '/lib/lsb/init-functions.d': Directory not empty
dpkg: warning: unable to delete old directory '/lib/lsb': Directory not empty
dpkg: warning: unable to delete old directory '/lib/init': Directory not empty
Setting up sysvinit-utils (3.08-6ubuntu3) ...
(Reading database ... 15495 files and directories currently installed.)
Preparing to unpack .../logsave_1.47.0-2.4~exp1ubuntu4_s390x.deb ...
Unpacking logsave (1.47.0-2.4~exp1ubuntu4) over (1.47.0-2ubuntu1) ...
dpkg: libext2fs2:s390x: dependency problems, but removing anyway as you requested:
 e2fsprogs depends on libext2fs2 (= 1.47.0-2ubuntu1).

(Reading database ... 15495 files and directories currently installed.)
Removing libext2fs2:s390x (1.47.0-2ubuntu1) ...
Selecting previously unselected package libext2fs2t64:s390x.
(Reading database ... 15488 files and directories currently installed.)
Preparing to unpack .../libext2fs2t64_1.47.0-2.4~exp1ubuntu4_s390x.deb ...
Adding 'diversion of /lib/s390x-linux-gnu/libe2p.so.2 to /lib/s390x-linux-gnu/libe2p.so.2.usr-is-merged by libext2fs2t64'
Adding 'diversion of /lib/s390x-linux-gnu/libe2p.so.2.3 to /lib/s390x-linux-gnu/libe2p.so.2.3.usr-is-merged by libext2fs2t64'
Adding 'diversion of /lib/s390x-linux-gnu/libext2fs.so.2 to /lib/s390x-linux-gnu/libext2fs.so.2.usr-is-merged by libext2fs2t64'
Adding 'diversion of /lib/s390x-linux-gnu/libext2fs.so.2.4 to /lib/s390x-linux-gnu/libext2fs.so.2.4.usr-is-merged by libext2fs2t64'
Unpacking libext2fs2t64:s390x (1.47.0-2.4~exp1ubuntu4) ...
Setting up libcom-err2:s390x (1.47.0-2.4~exp1ubuntu4) ...
Setting up libext2fs2t64:s390x (1.47.0-2.4~exp1ubuntu4) ...
(Reading database ... 15504 files and directories currently installed.)
Preparing to unpack .../e2fsprogs_1.47.0-2.4~exp1ubuntu4_s390x.deb ...
Unpacking e2fsprogs (1.47.0-2.4~exp1ubuntu4) over (1.47.0-2ubuntu1) ...
dpkg: warning: unable to delete old directory '/lib/udev/rules.d': Directory not empty
dpkg: warning: unable to delete old directory '/lib/udev': Directory not empty
Preparing to unpack .../optipng_0.7.8+ds-1build2_s390x.deb ...
Unpacking optipng (0.7.8+ds-1build2) over (0.7.7-2build1) ...
(Reading database ... 15502 files and directories currently installed.)
Removing libpng16-16:s390x (1.6.40-1) ...
Selecting previously unselected package libpng16-16t64:s390x.
(Reading database ... 15492 files and directories currently installed.)
Preparing to unpack .../libpng16-16t64_1.6.43-5build1_s390x.deb ...
Unpacking libpng16-16t64:s390x (1.6.43-5build1) ...
Setting up libapparmor1:s390x (4.0.0-beta3-0ubuntu3) ...
Setting up libargon2-1:s390x (0~20190702+dfsg-4build1) ...
Setting up libdevmapper1.02.1:s390x (2:1.02.185-3ubuntu3) ...
Setting up libjson-c5:s390x (0.17-1build1) ...
Setting up libcryptsetup12:s390x (2:2.7.0-1ubuntu4) ...
Setting up libfdisk1:s390x (2.39.3-9ubuntu6) ...
Setting up libkmod2:s390x (31+20240202-2ubuntu7) ...
Setting up libsystemd-shared:s390x (255.4-1ubuntu8) ...
Setting up systemd-dev (255.4-1ubuntu8) ...
Setting up mount (2.39.3-9ubuntu6) ...
Setting up systemd (255.4-1ubuntu8) ...
Installing new version of config file /etc/systemd/journald.conf ...
Installing new version of config file /etc/systemd/logind.conf ...
Installing new version of config file /etc/systemd/networkd.conf ...
Installing new version of config file /etc/systemd/pstore.conf ...
Installing new version of config file /etc/systemd/sleep.conf ...
Installing new version of config file /etc/systemd/system.conf ...
Installing new version of config file /etc/systemd/user.conf ...
Initializing machine ID from random generator.
Setting up systemd-sysv (255.4-1ubuntu8) ...
(Reading database ... 15503 files and directories currently installed.)
Preparing to unpack .../init_1.66ubuntu1_s390x.deb ...
Unpacking init (1.66ubuntu1) over (1.65.2ubuntu1) ...
Preparing to unpack .../libsmartcols1_2.39.3-9ubuntu6_s390x.deb ...
Unpacking libsmartcols1:s390x (2.39.3-9ubuntu6) over (2.39.1-4ubuntu2) ...
Setting up libsmartcols1:s390x (2.39.3-9ubuntu6) ...
(Reading database ... 15504 files and directories currently installed.)
Preparing to unpack .../uuid-runtime_2.39.3-9ubuntu6_s390x.deb ...
Unpacking uuid-runtime (2.39.3-9ubuntu6) over (2.39.1-4ubuntu2) ...
dpkg: warning: unable to delete old directory '/lib/systemd/system': Directory not empty
dpkg: warning: unable to delete old directory '/lib/systemd': Directory not empty
Preparing to unpack .../libattr1_1%3a2.5.2-1build1_s390x.deb ...
Unpacking libattr1:s390x (1:2.5.2-1build1) over (1:2.5.1-4) ...
Setting up libattr1:s390x (1:2.5.2-1build1) ...
(Reading database ... 15502 files and directories currently installed.)
Preparing to unpack .../libmd0_1.1.0-2build1_s390x.deb ...
Unpacking libmd0:s390x (1.1.0-2build1) over (1.1.0-1) ...
Setting up libmd0:s390x (1.1.0-2build1) ...
(Reading database ... 15502 files and directories currently installed.)
Preparing to unpack .../libpam-runtime_1.5.3-5ubuntu5_all.deb ...
Unpacking libpam-runtime (1.5.3-5ubuntu5) over (1.5.2-6ubuntu1) ...
Setting up libpam-runtime (1.5.3-5ubuntu5) ...
(Reading database ... 15501 files and directories currently installed.)
Preparing to unpack .../libsemanage-common_3.5-1build5_all.deb ...
Unpacking libsemanage-common (3.5-1build5) over (3.5-1) ...
Setting up libsemanage-common (3.5-1build5) ...
(Reading database ... 15501 files and directories currently installed.)
Preparing to unpack .../libsepol2_3.5-2build1_s390x.deb ...
Unpacking libsepol2:s390x (3.5-2build1) over (3.5-1) ...
Setting up libsepol2:s390x (3.5-2build1) ...
(Reading database ... 15501 files and directories currently installed.)
Preparing to unpack .../libsemanage2_3.5-1build5_s390x.deb ...
Unpacking libsemanage2:s390x (3.5-1build5) over (3.5-1) ...
Setting up libsemanage2:s390x (3.5-1build5) ...
(Reading database ... 15501 files and directories currently installed.)
Preparing to unpack .../passwd_1%3a4.13+dfsg1-4ubuntu3_s390x.deb ...
Unpacking passwd (1:4.13+dfsg1-4ubuntu3) over (1:4.13+dfsg1-1ubuntu1) ...
Setting up passwd (1:4.13+dfsg1-4ubuntu3) ...
(Reading database ... 15501 files and directories currently installed.)
Preparing to unpack .../00-libproc2-0_2%3a4.0.4-4ubuntu3_s390x.deb ...
Unpacking libproc2-0:s390x (2:4.0.4-4ubuntu3) over (2:4.0.3-1ubuntu1) ...
Preparing to unpack .../01-libss2_1.47.0-2.4~exp1ubuntu4_s390x.deb ...
Unpacking libss2:s390x (1.47.0-2.4~exp1ubuntu4) over (1.47.0-2ubuntu1) ...
Preparing to unpack .../02-mawk_1.3.4.20240123-1build1_s390x.deb ...
Unpacking mawk (1.3.4.20240123-1build1) over (1.3.4.20230730-1) ...
Preparing to unpack .../03-procps_2%3a4.0.4-4ubuntu3_s390x.deb ...
Unpacking procps (2:4.0.4-4ubuntu3) over (2:4.0.3-1ubuntu1) ...
Preparing to unpack .../04-sensible-utils_0.0.22_all.deb ...
Unpacking sensible-utils (0.0.22) over (0.0.20) ...
Preparing to unpack .../05-ca-certificates_20240203_all.deb ...
Unpacking ca-certificates (20240203) over (20230311ubuntu1) ...
Preparing to unpack .../06-krb5-locales_1.20.1-6ubuntu2_all.deb ...
Unpacking krb5-locales (1.20.1-6ubuntu2) over (1.20.1-3ubuntu1) ...
Preparing to unpack .../07-tzdata_2024a-2ubuntu1_all.deb ...
Unpacking tzdata (2024a-2ubuntu1) over (2023c-9ubuntu1) ...
Preparing to unpack .../08-bash-completion_1%3a2.11-8_all.deb ...
Unpacking bash-completion (1:2.11-8) over (1:2.11-7) ...
Preparing to unpack .../09-bsdextrautils_2.39.3-9ubuntu6_s390x.deb ...
Unpacking bsdextrautils (2.39.3-9ubuntu6) over (2.39.1-4ubuntu2) ...
Preparing to unpack .../10-libgpm2_1.20.7-11_s390x.deb ...
Unpacking libgpm2:s390x (1.20.7-11) over (1.20.7-10build1) ...
Preparing to unpack .../11-libip4tc2_1.8.10-3ubuntu2_s390x.deb ...
Unpacking libip4tc2:s390x (1.8.10-3ubuntu2) over (1.8.9-2ubuntu2) ...
Preparing to unpack .../12-libjansson4_2.14-2build2_s390x.deb ...
Unpacking libjansson4:s390x (2.14-2build2) over (2.14-2) ...
Preparing to unpack .../13-psmisc_23.7-1build1_s390x.deb ...
Unpacking psmisc (23.7-1build1) over (23.6-1) ...
Preparing to unpack .../14-xz-utils_5.6.1+really5.4.5-1_s390x.deb ...
Unpacking xz-utils (5.6.1+really5.4.5-1) over (5.4.1-0.2) ...
Preparing to unpack .../15-advancecomp_2.5-1build1_s390x.deb ...
Unpacking advancecomp (2.5-1build1) over (2.5-1) ...
Preparing to unpack .../16-libctf0_2.42-4ubuntu2_s390x.deb ...
Unpacking libctf0:s390x (2.42-4ubuntu2) over (2.41-5ubuntu1) ...
Preparing to unpack .../17-libctf-nobfd0_2.42-4ubuntu2_s390x.deb ...
Unpacking libctf-nobfd0:s390x (2.42-4ubuntu2) over (2.41-5ubuntu1) ...
Preparing to unpack .../18-binutils-s390x-linux-gnu_2.42-4ubuntu2_s390x.deb ...
Unpacking binutils-s390x-linux-gnu (2.42-4ubuntu2) over (2.41-5ubuntu1) ...
Preparing to unpack .../19-libbinutils_2.42-4ubuntu2_s390x.deb ...
Unpacking libbinutils:s390x (2.42-4ubuntu2) over (2.41-5ubuntu1) ...
Preparing to unpack .../20-binutils_2.42-4ubuntu2_s390x.deb ...
Unpacking binutils (2.42-4ubuntu2) over (2.41-5ubuntu1) ...
Preparing to unpack .../21-binutils-common_2.42-4ubuntu2_s390x.deb ...
Unpacking binutils-common:s390x (2.42-4ubuntu2) over (2.41-5ubuntu1) ...
Preparing to unpack .../22-libsframe1_2.42-4ubuntu2_s390x.deb ...
Unpacking libsframe1:s390x (2.42-4ubuntu2) over (2.41-5ubuntu1) ...
Preparing to unpack .../23-libisl23_0.26-3build1_s390x.deb ...
Unpacking libisl23:s390x (0.26-3build1) over (0.26-3) ...
Preparing to unpack .../24-libmpfr6_4.2.1-1build1_s390x.deb ...
Unpacking libmpfr6:s390x (4.2.1-1build1) over (4.2.1-1) ...
Preparing to unpack .../25-libmpc3_1.3.1-1build1_s390x.deb ...
Unpacking libmpc3:s390x (1.3.1-1build1) over (1.3.1-1) ...
Selecting previously unselected package cpp-14-s390x-linux-gnu.
Preparing to unpack .../26-cpp-14-s390x-linux-gnu_14-20240429-1ubuntu1_s390x.deb ...
Unpacking cpp-14-s390x-linux-gnu (14-20240429-1ubuntu1) ...
Preparing to unpack .../27-g++_4%3a14-20240120-6ubuntu1_s390x.deb ...
Unpacking g++ (4:14-20240120-6ubuntu1) over (4:13.2.0-1ubuntu1) ...
Preparing to unpack .../28-gcc_4%3a14-20240120-6ubuntu1_s390x.deb ...
Unpacking gcc (4:14-20240120-6ubuntu1) over (4:13.2.0-1ubuntu1) ...
Preparing to unpack .../29-cpp_4%3a14-20240120-6ubuntu1_s390x.deb ...
Unpacking cpp (4:14-20240120-6ubuntu1) over (4:13.2.0-1ubuntu1) ...
Selecting previously unselected package cpp-s390x-linux-gnu.
Preparing to unpack .../30-cpp-s390x-linux-gnu_4%3a14-20240120-6ubuntu1_s390x.deb ...
Unpacking cpp-s390x-linux-gnu (4:14-20240120-6ubuntu1) ...
Preparing to unpack .../31-libcc1-0_14-20240429-1ubuntu1_s390x.deb ...
Unpacking libcc1-0:s390x (14-20240429-1ubuntu1) over (13.2.0-4ubuntu3) ...
Preparing to unpack .../32-libgomp1_14-20240429-1ubuntu1_s390x.deb ...
Unpacking libgomp1:s390x (14-20240429-1ubuntu1) over (13.2.0-4ubuntu3) ...
Preparing to unpack .../33-libitm1_14-20240429-1ubuntu1_s390x.deb ...
Unpacking libitm1:s390x (14-20240429-1ubuntu1) over (13.2.0-4ubuntu3) ...
Preparing to unpack .../34-libatomic1_14-20240429-1ubuntu1_s390x.deb ...
Unpacking libatomic1:s390x (14-20240429-1ubuntu1) over (13.2.0-4ubuntu3) ...
Preparing to unpack .../35-libasan8_14-20240429-1ubuntu1_s390x.deb ...
Unpacking libasan8:s390x (14-20240429-1ubuntu1) over (13.2.0-4ubuntu3) ...
Preparing to unpack .../36-libubsan1_14-20240429-1ubuntu1_s390x.deb ...
Unpacking libubsan1:s390x (14-20240429-1ubuntu1) over (13.2.0-4ubuntu3) ...
Selecting previously unselected package libgcc-14-dev:s390x.
Preparing to unpack .../37-libgcc-14-dev_14-20240429-1ubuntu1_s390x.deb ...
Unpacking libgcc-14-dev:s390x (14-20240429-1ubuntu1) ...
Selecting previously unselected package gcc-14-s390x-linux-gnu.
Preparing to unpack .../38-gcc-14-s390x-linux-gnu_14-20240429-1ubuntu1_s390x.deb ...
Unpacking gcc-14-s390x-linux-gnu (14-20240429-1ubuntu1) ...
Selecting previously unselected package libstdc++-14-dev:s390x.
Preparing to unpack .../39-libstdc++-14-dev_14-20240429-1ubuntu1_s390x.deb ...
Unpacking libstdc++-14-dev:s390x (14-20240429-1ubuntu1) ...
Selecting previously unselected package g++-14-s390x-linux-gnu.
Preparing to unpack .../40-g++-14-s390x-linux-gnu_14-20240429-1ubuntu1_s390x.deb ...
Unpacking g++-14-s390x-linux-gnu (14-20240429-1ubuntu1) ...
Selecting previously unselected package gcc-14.
Preparing to unpack .../41-gcc-14_14-20240429-1ubuntu1_s390x.deb ...
Unpacking gcc-14 (14-20240429-1ubuntu1) ...
Selecting previously unselected package g++-14.
Preparing to unpack .../42-g++-14_14-20240429-1ubuntu1_s390x.deb ...
Unpacking g++-14 (14-20240429-1ubuntu1) ...
Selecting previously unselected package gcc-s390x-linux-gnu.
Preparing to unpack .../43-gcc-s390x-linux-gnu_4%3a14-20240120-6ubuntu1_s390x.deb ...
Unpacking gcc-s390x-linux-gnu (4:14-20240120-6ubuntu1) ...
Selecting previously unselected package g++-s390x-linux-gnu.
Preparing to unpack .../44-g++-s390x-linux-gnu_4%3a14-20240120-6ubuntu1_s390x.deb ...
Unpacking g++-s390x-linux-gnu (4:14-20240120-6ubuntu1) ...
Selecting previously unselected package cpp-14.
Preparing to unpack .../45-cpp-14_14-20240429-1ubuntu1_s390x.deb ...
Unpacking cpp-14 (14-20240429-1ubuntu1) ...
Preparing to unpack .../46-g++-13_13.2.0-24ubuntu1_s390x.deb ...
Unpacking g++-13 (13.2.0-24ubuntu1) over (13.2.0-4ubuntu3) ...
Preparing to unpack .../47-gcc-13_13.2.0-24ubuntu1_s390x.deb ...
Unpacking gcc-13 (13.2.0-24ubuntu1) over (13.2.0-4ubuntu3) ...
Preparing to unpack .../48-libstdc++-13-dev_13.2.0-24ubuntu1_s390x.deb ...
Unpacking libstdc++-13-dev:s390x (13.2.0-24ubuntu1) over (13.2.0-4ubuntu3) ...
Preparing to unpack .../49-libgcc-13-dev_13.2.0-24ubuntu1_s390x.deb ...
Unpacking libgcc-13-dev:s390x (13.2.0-24ubuntu1) over (13.2.0-4ubuntu3) ...
Preparing to unpack .../50-cpp-13_13.2.0-24ubuntu1_s390x.deb ...
Unpacking cpp-13 (13.2.0-24ubuntu1) over (13.2.0-4ubuntu3) ...
Preparing to unpack .../51-gcc-13-base_13.2.0-24ubuntu1_s390x.deb ...
Unpacking gcc-13-base:s390x (13.2.0-24ubuntu1) over (13.2.0-4ubuntu3) ...
Selecting previously unselected package cpp-13-s390x-linux-gnu.
Preparing to unpack .../52-cpp-13-s390x-linux-gnu_13.2.0-24ubuntu1_s390x.deb ...
Unpacking cpp-13-s390x-linux-gnu (13.2.0-24ubuntu1) ...
Selecting previously unselected package gcc-13-s390x-linux-gnu.
Preparing to unpack .../53-gcc-13-s390x-linux-gnu_13.2.0-24ubuntu1_s390x.deb ...
Unpacking gcc-13-s390x-linux-gnu (13.2.0-24ubuntu1) ...
Selecting previously unselected package g++-13-s390x-linux-gnu.
Preparing to unpack .../54-g++-13-s390x-linux-gnu_13.2.0-24ubuntu1_s390x.deb ...
Unpacking g++-13-s390x-linux-gnu (13.2.0-24ubuntu1) ...
Preparing to unpack .../55-dpkg-dev_1.22.6ubuntu6_all.deb ...
Unpacking dpkg-dev (1.22.6ubuntu6) over (1.22.0ubuntu1) ...
Preparing to unpack .../56-libdpkg-perl_1.22.6ubuntu6_all.deb ...
Unpacking libdpkg-perl (1.22.6ubuntu6) over (1.22.0ubuntu1) ...
Preparing to unpack .../57-patch_2.7.6-7build3_s390x.deb ...
Unpacking patch (2.7.6-7build3) over (2.7.6-7build2) ...
Preparing to unpack .../58-make_4.3-4.1build2_s390x.deb ...
Unpacking make (4.3-4.1build2) over (4.3-4.1build1) ...
Preparing to unpack .../59-lto-disabled-list_47_all.deb ...
Unpacking lto-disabled-list (47) over (43) ...
Preparing to unpack .../60-libfakeroot_1.33-1_s390x.deb ...
Unpacking libfakeroot:s390x (1.33-1) over (1.32.1-1) ...
Preparing to unpack .../61-fakeroot_1.33-1_s390x.deb ...
Unpacking fakeroot (1.33-1) over (1.32.1-1) ...
Preparing to unpack .../62-liblockfile-bin_1.17-1build3_s390x.deb ...
Unpacking liblockfile-bin (1.17-1build3) over (1.17-1build2) ...
Preparing to unpack .../63-liblockfile1_1.17-1build3_s390x.deb ...
Unpacking liblockfile1:s390x (1.17-1build3) over (1.17-1build2) ...
Preparing to unpack .../64-lockfile-progs_0.1.19build2_s390x.deb ...
Unpacking lockfile-progs (0.1.19build2) over (0.1.19build1) ...
Setting up libip4tc2:s390x (1.8.10-3ubuntu2) ...
Setting up libtext-iconv-perl:s390x (1.7-8build3) ...
Setting up libtext-charwidth-perl:s390x (0.04-11build3) ...
Setting up libkeyutils1:s390x (1.6.3-3build1) ...
Setting up lto-disabled-list (47) ...
Setting up libgpm2:s390x (1.20.7-11) ...
Setting up liblockfile-bin (1.17-1build3) ...
Setting up libgdbm6t64:s390x (1.23-5.1build1) ...
Setting up bsdextrautils (2.39.3-9ubuntu6) ...
Setting up init (1.66ubuntu1) ...
Setting up libgdbm-compat4t64:s390x (1.23-5.1build1) ...
Setting up psmisc (23.7-1build1) ...
Setting up libtirpc-common (1.3.4+ds-1.1build1) ...
Setting up libsqlite3-0:s390x (3.45.1-1ubuntu2) ...
Setting up binutils-common:s390x (2.42-4ubuntu2) ...
Setting up linux-libc-dev:s390x (6.8.0-31.31) ...
Setting up libctf-nobfd0:s390x (2.42-4ubuntu2) ...
Setting up krb5-locales (1.20.1-6ubuntu2) ...
Setting up libgomp1:s390x (14-20240429-1ubuntu1) ...
Setting up bzip2 (1.0.8-5.1) ...
Setting up libsframe1:s390x (2.42-4ubuntu2) ...
Setting up libfakeroot:s390x (1.33-1) ...
Setting up libjansson4:s390x (2.14-2build2) ...
Setting up libkrb5support0:s390x (1.20.1-6ubuntu2) ...
Setting up tzdata (2024a-2ubuntu1) ...

Current default time zone: 'Etc/UTC'
Local time is now:      Sat May 18 19:44:40 UTC 2024.
Universal Time is now:  Sat May 18 19:44:40 UTC 2024.
Run 'dpkg-reconfigure tzdata' if you wish to change it.

Setting up fakeroot (1.33-1) ...
Setting up rpcsvc-proto (1.4.2-0ubuntu7) ...
Setting up gcc-13-base:s390x (13.2.0-24ubuntu1) ...
Setting up make (4.3-4.1build2) ...
Setting up libmpfr6:s390x (4.2.1-1build1) ...
Setting up bash-completion (1:2.11-8) ...
Setting up xz-utils (5.6.1+really5.4.5-1) ...
Setting up perl-modules-5.38 (5.38.2-3.2build2) ...
Setting up libproc2-0:s390x (2:4.0.4-4ubuntu3) ...
Setting up libpng16-16t64:s390x (1.6.43-5build1) ...
Setting up libmpc3:s390x (1.3.1-1build1) ...
Setting up libatomic1:s390x (14-20240429-1ubuntu1) ...
Setting up patch (2.7.6-7build3) ...
Setting up libss2:s390x (1.47.0-2.4~exp1ubuntu4) ...
Setting up libncursesw6:s390x (6.4+20240113-1ubuntu2) ...
Setting up libk5crypto3:s390x (1.20.1-6ubuntu2) ...
Setting up logsave (1.47.0-2.4~exp1ubuntu4) ...
Setting up libdb5.3t64:s390x (5.3.28+dfsg2-7) ...
Setting up libubsan1:s390x (14-20240429-1ubuntu1) ...
Setting up advancecomp (2.5-1build1) ...
Setting up sensible-utils (0.0.22) ...
Setting up uuid-runtime (2.39.3-9ubuntu6) ...
Running in chroot, ignoring request.
invoke-rc.d: policy-rc.d denied execution of restart.
Setting up libcrypt-dev:s390x (1:4.4.36-4build1) ...
Setting up libasan8:s390x (14-20240429-1ubuntu1) ...
Setting up procps (2:4.0.4-4ubuntu3) ...
Installing new version of config file /etc/sysctl.conf ...
Setting up mawk (1.3.4.20240123-1build1) ...
Setting up libkrb5-3:s390x (1.20.1-6ubuntu2) ...
Setting up liblockfile1:s390x (1.17-1build3) ...
Setting up libperl5.38t64:s390x (5.38.2-3.2build2) ...
Setting up libbinutils:s390x (2.42-4ubuntu2) ...
Setting up libisl23:s390x (0.26-3build1) ...
Setting up libc-dev-bin (2.39-0ubuntu8) ...
Setting up openssl (3.0.13-0ubuntu3) ...
Setting up libgpg-error-l10n (1.47-3build2) ...
Setting up readline-common (8.2-4build1) ...
Setting up libcc1-0:s390x (14-20240429-1ubuntu1) ...
Setting up liblocale-gettext-perl (1.07-6ubuntu5) ...
Setting up libitm1:s390x (14-20240429-1ubuntu1) ...
Setting up libctf0:s390x (2.42-4ubuntu2) ...
Setting up pinentry-curses (1.2.1-3ubuntu5) ...
Setting up apt-utils (2.7.14build2) ...
Setting up binutils-s390x-linux-gnu (2.42-4ubuntu2) ...
Setting up debconf-i18n (1.5.86ubuntu1) ...
Setting up e2fsprogs (1.47.0-2.4~exp1ubuntu4) ...
Setting up binutils (2.42-4ubuntu2) ...
Setting up ca-certificates (20240203) ...
Updating certificates in /etc/ssl/certs...
rehash: warning: skipping ca-certificates.crt,it does not contain exactly one certificate or CRL
14 added, 5 removed; done.
Setting up perl (5.38.2-3.2build2) ...
Setting up cpp-13-s390x-linux-gnu (13.2.0-24ubuntu1) ...
Setting up optipng (0.7.8+ds-1build2) ...
Setting up lockfile-progs (0.1.19build2) ...
Setting up libgssapi-krb5-2:s390x (1.20.1-6ubuntu2) ...
Setting up libdpkg-perl (1.22.6ubuntu6) ...
Setting up cpp-14-s390x-linux-gnu (14-20240429-1ubuntu1) ...
Setting up cpp-14 (14-20240429-1ubuntu1) ...
Setting up libreadline8t64:s390x (8.2-4build1) ...
Setting up libgcc-13-dev:s390x (13.2.0-24ubuntu1) ...
Setting up gpgconf (2.4.4-2ubuntu17) ...
Setting up libc6-dev:s390x (2.39-0ubuntu8) ...
Setting up libgcc-14-dev:s390x (14-20240429-1ubuntu1) ...
Setting up libstdc++-14-dev:s390x (14-20240429-1ubuntu1) ...
Setting up gpg (2.4.4-2ubuntu17) ...
Setting up libstdc++-13-dev:s390x (13.2.0-24ubuntu1) ...
Setting up gpg-agent (2.4.4-2ubuntu17) ...
Setting up cpp-13 (13.2.0-24ubuntu1) ...
Setting up cpp-s390x-linux-gnu (4:14-20240120-6ubuntu1) ...
Setting up libtirpc3t64:s390x (1.3.4+ds-1.1build1) ...
Setting up dpkg-dev (1.22.6ubuntu6) ...
Setting up gcc-14-s390x-linux-gnu (14-20240429-1ubuntu1) ...
Setting up libtirpc-dev:s390x (1.3.4+ds-1.1build1) ...
Setting up gcc-13-s390x-linux-gnu (13.2.0-24ubuntu1) ...
Setting up gcc-s390x-linux-gnu (4:14-20240120-6ubuntu1) ...
Setting up g++-13-s390x-linux-gnu (13.2.0-24ubuntu1) ...
Setting up gcc-13 (13.2.0-24ubuntu1) ...
Setting up g++-14-s390x-linux-gnu (14-20240429-1ubuntu1) ...
Setting up cpp (4:14-20240120-6ubuntu1) ...
Setting up libnsl2:s390x (1.3.0-3build3) ...
Setting up g++-13 (13.2.0-24ubuntu1) ...
Setting up g++-s390x-linux-gnu (4:14-20240120-6ubuntu1) ...
Setting up libnss-nisplus:s390x (1.3-5build1) ...
Setting up gcc-14 (14-20240429-1ubuntu1) ...
Setting up libnss-nis:s390x (3.1-0ubuntu7) ...
Setting up libnsl-dev:s390x (1.3.0-3build3) ...
Setting up g++-14 (14-20240429-1ubuntu1) ...
Setting up gcc (4:14-20240120-6ubuntu1) ...
Setting up g++ (4:14-20240120-6ubuntu1) ...
Processing triggers for libc-bin (2.39-0ubuntu8) ...
Processing triggers for debianutils (5.17build1) ...
(Reading database ... 16559 files and directories currently installed.)
Purging configuration files for libssl3:s390x (3.0.10-1ubuntu2) ...
Processing triggers for ca-certificates (20240203) ...
Updating certificates in /etc/ssl/certs...
0 added, 0 removed; done.
Running hooks in /etc/ca-certificates/update.d...
done.
RUN: /usr/share/launchpad-buildd/bin/sbuild-package PACKAGEBUILD-28294924 s390x noble -c chroot:build-PACKAGEBUILD-28294924 --arch=s390x --dist=noble --nolog ataqv_1.3.1+ds-2build3.dsc
Initiating build PACKAGEBUILD-28294924 with 4 jobs across 4 processor cores.
Kernel reported to sbuild: 5.4.0-182-generic #202-Ubuntu SMP Fri Apr 26 12:29:12 UTC 2024 s390x
sbuild (Debian sbuild) 0.79.0 (05 February 2020) on bos02-s390x-011.buildd

+==============================================================================+
| ataqv 1.3.1+ds-2build3 (s390x)               Sat, 18 May 2024 19:44:52 +0000 |
+==============================================================================+

Package: ataqv
Version: 1.3.1+ds-2build3
Source Version: 1.3.1+ds-2build3
Distribution: noble
Machine Architecture: s390x
Host Architecture: s390x
Build Architecture: s390x
Build Type: any

I: NOTICE: Log filtering will replace 'home/buildd/build-PACKAGEBUILD-28294924/chroot-autobuild' with '<<CHROOT>>'
I: NOTICE: Log filtering will replace 'build/ataqv-MHQJdq/resolver-86jeGF' with '<<RESOLVERDIR>>'

+------------------------------------------------------------------------------+
| Fetch source files                                                           |
+------------------------------------------------------------------------------+


Local sources
-------------

ataqv_1.3.1+ds-2build3.dsc exists in .; copying to chroot
I: NOTICE: Log filtering will replace 'build/ataqv-MHQJdq/ataqv-1.3.1+ds' with '<<PKGBUILDDIR>>'
I: NOTICE: Log filtering will replace 'build/ataqv-MHQJdq' with '<<BUILDDIR>>'

+------------------------------------------------------------------------------+
| Install package build dependencies                                           |
+------------------------------------------------------------------------------+


Setup apt archive
-----------------

Merged Build-Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3, debhelper, build-essential, fakeroot
Filtered Build-Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3, debhelper, build-essential, fakeroot
dpkg-deb: building package 'sbuild-build-depends-main-dummy' in '/<<RESOLVERDIR>>/apt_archive/sbuild-build-depends-main-dummy.deb'.
Ign:1 copy:/<<RESOLVERDIR>>/apt_archive ./ InRelease
Get:2 copy:/<<RESOLVERDIR>>/apt_archive ./ Release [957 B]
Ign:3 copy:/<<RESOLVERDIR>>/apt_archive ./ Release.gpg
Get:4 copy:/<<RESOLVERDIR>>/apt_archive ./ Sources [492 B]
Get:5 copy:/<<RESOLVERDIR>>/apt_archive ./ Packages [570 B]
Fetched 2019 B in 0s (58.7 kB/s)
Reading package lists...
Reading package lists...

Install main build dependencies (apt-based resolver)
----------------------------------------------------

Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following packages were automatically installed and are no longer required:
  apt-utils bash-completion ca-certificates cpp-13 debconf-i18n g++-13
  g++-13-s390x-linux-gnu krb5-locales libgpg-error-l10n libgpm2 libip4tc2
  libnsl-dev libnsl2 libnss-nis libnss-nisplus libperl5.36
  libtext-charwidth-perl libtext-iconv-perl libtext-wrapi18n-perl
  libtirpc-common libtirpc-dev libtirpc3t64 libunistring2 openssl
  perl-modules-5.36 psmisc uuid-runtime
Use 'apt autoremove' to remove them.
The following additional packages will be installed:
  autoconf automake autopoint autotools-dev debhelper debugedit dh-autoreconf
  dh-strip-nondeterminism dwz file fonts-font-awesome gettext gettext-base
  groff-base help2man icu-devtools intltool-debian libarchive-zip-perl
  libboost-atomic1.83-dev libboost-atomic1.83.0 libboost-chrono-dev
  libboost-chrono1.83-dev libboost-chrono1.83.0t64 libboost-filesystem-dev
  libboost-filesystem1.83-dev libboost-filesystem1.83.0 libboost-iostreams-dev
  libboost-iostreams1.83-dev libboost-iostreams1.83.0 libboost-regex1.83-dev
  libboost-regex1.83.0 libboost-system-dev libboost-system1.83-dev
  libboost-system1.83.0 libboost1.83-dev libbrotli1 libcurl3t64-gnutls
  libcurl4-gnutls-dev libdebhelper-perl libdeflate-dev libdeflate0 libdw1t64
  libelf1t64 libexpat1 libfile-stripnondeterminism-perl libhts-dev libhts3t64
  libhtscodecs2 libicu-dev libicu74 libjs-d3-format libjs-jquery
  libjs-jquery-datatables libjs-jquery-datatables-extensions libldap2
  liblzma-dev libmagic-mgc libmagic1t64 libncurses-dev libncurses6
  libnghttp2-14 libpipeline1 libpsl5t64 libpython3-stdlib
  libpython3.12-minimal libpython3.12-stdlib librtmp1 libsasl2-2
  libsasl2-modules-db libssh-4 libsub-override-perl libtool libuchardet0
  libxml2 m4 man-db media-types netbase node-commander node-d3 node-d3-array
  node-d3-axis node-d3-brush node-d3-chord node-d3-collection node-d3-color
  node-d3-contour node-d3-dispatch node-d3-drag node-d3-dsv node-d3-ease
  node-d3-fetch node-d3-force node-d3-format node-d3-geo node-d3-hierarchy
  node-d3-interpolate node-d3-path node-d3-polygon node-d3-quadtree
  node-d3-queue node-d3-random node-d3-scale node-d3-scale-chromatic
  node-d3-selection node-d3-shape node-d3-time node-d3-time-format
  node-d3-timer node-d3-transition node-d3-voronoi node-d3-zoom
  node-iconv-lite node-normalize.css node-rw node-safe-buffer po-debconf
  python3 python3-minimal python3.12 python3.12-minimal zlib1g-dev
Suggested packages:
  autoconf-archive gnu-standards autoconf-doc dh-make gettext-doc
  libasprintf-dev libgettextpo-dev groff libboost1.83-doc
  libboost-container1.83-dev libboost-context1.83-dev
  libboost-contract1.83-dev libboost-coroutine1.83-dev
  libboost-date-time1.83-dev libboost-exception1.83-dev libboost-fiber1.83-dev
  libboost-graph-parallel1.83-dev libboost-graph1.83-dev libboost-json1.83-dev
  libboost-locale1.83-dev libboost-log1.83-dev libboost-math1.83-dev
  libboost-mpi-python1.83-dev libboost-mpi1.83-dev libboost-nowide1.83-dev
  libboost-numpy1.83-dev libboost-program-options1.83-dev
  libboost-python1.83-dev libboost-random1.83-dev
  libboost-serialization1.83-dev libboost-stacktrace1.83-dev
  libboost-test1.83-dev libboost-thread1.83-dev libboost-timer1.83-dev
  libboost-type-erasure1.83-dev libboost-url1.83-dev libboost-wave1.83-dev
  libboost1.83-tools-dev libmpfrc++-dev libntl-dev libcurl4-doc
  libgnutls28-dev libidn-dev libkrb5-dev libldap2-dev librtmp-dev
  libssh2-1-dev pkg-config icu-doc liblzma-doc ncurses-doc libtool-doc
  gfortran | fortran95-compiler gcj-jdk m4-doc apparmor less www-browser
  libjs-html5shiv libmail-box-perl python3-doc python3-tk python3-venv
  python3.12-venv python3.12-doc binfmt-support
Recommended packages:
  curl | wget | lynx libarchive-cpio-perl javascript-common libldap-common
  publicsuffix libsasl2-modules libltdl-dev libmail-sendmail-perl
The following NEW packages will be installed:
  autoconf automake autopoint autotools-dev debhelper debugedit dh-autoreconf
  dh-strip-nondeterminism dwz file fonts-font-awesome gettext gettext-base
  groff-base help2man icu-devtools intltool-debian libarchive-zip-perl
  libboost-atomic1.83-dev libboost-atomic1.83.0 libboost-chrono-dev
  libboost-chrono1.83-dev libboost-chrono1.83.0t64 libboost-filesystem-dev
  libboost-filesystem1.83-dev libboost-filesystem1.83.0 libboost-iostreams-dev
  libboost-iostreams1.83-dev libboost-iostreams1.83.0 libboost-regex1.83-dev
  libboost-regex1.83.0 libboost-system-dev libboost-system1.83-dev
  libboost-system1.83.0 libboost1.83-dev libbrotli1 libcurl3t64-gnutls
  libcurl4-gnutls-dev libdebhelper-perl libdeflate-dev libdeflate0 libdw1t64
  libelf1t64 libexpat1 libfile-stripnondeterminism-perl libhts-dev libhts3t64
  libhtscodecs2 libicu-dev libicu74 libjs-d3-format libjs-jquery
  libjs-jquery-datatables libjs-jquery-datatables-extensions libldap2
  liblzma-dev libmagic-mgc libmagic1t64 libncurses-dev libncurses6
  libnghttp2-14 libpipeline1 libpsl5t64 libpython3-stdlib
  libpython3.12-minimal libpython3.12-stdlib librtmp1 libsasl2-2
  libsasl2-modules-db libssh-4 libsub-override-perl libtool libuchardet0
  libxml2 m4 man-db media-types netbase node-commander node-d3 node-d3-array
  node-d3-axis node-d3-brush node-d3-chord node-d3-collection node-d3-color
  node-d3-contour node-d3-dispatch node-d3-drag node-d3-dsv node-d3-ease
  node-d3-fetch node-d3-force node-d3-format node-d3-geo node-d3-hierarchy
  node-d3-interpolate node-d3-path node-d3-polygon node-d3-quadtree
  node-d3-queue node-d3-random node-d3-scale node-d3-scale-chromatic
  node-d3-selection node-d3-shape node-d3-time node-d3-time-format
  node-d3-timer node-d3-transition node-d3-voronoi node-d3-zoom
  node-iconv-lite node-normalize.css node-rw node-safe-buffer po-debconf
  python3 python3-minimal python3.12 python3.12-minimal
  sbuild-build-depends-main-dummy zlib1g-dev
0 upgraded, 123 newly installed, 0 to remove and 0 not upgraded.
Need to get 64.9 MB of archives.
After this operation, 371 MB of additional disk space will be used.
Get:1 copy:/<<RESOLVERDIR>>/apt_archive ./ sbuild-build-depends-main-dummy 0.invalid.0 [790 B]
Get:2 http://ftpmaster.internal/ubuntu noble/main s390x libpython3.12-minimal s390x 3.12.3-1 [830 kB]
Get:3 http://ftpmaster.internal/ubuntu noble/main s390x libexpat1 s390x 2.6.1-2build1 [94.4 kB]
Get:4 http://ftpmaster.internal/ubuntu noble/main s390x python3.12-minimal s390x 3.12.3-1 [2460 kB]
Get:5 http://ftpmaster.internal/ubuntu noble/main s390x python3-minimal s390x 3.12.3-0ubuntu1 [27.2 kB]
Get:6 http://ftpmaster.internal/ubuntu noble/main s390x media-types all 10.1.0 [27.5 kB]
Get:7 http://ftpmaster.internal/ubuntu noble/main s390x netbase all 6.4 [13.1 kB]
Get:8 http://ftpmaster.internal/ubuntu noble/main s390x libpython3.12-stdlib s390x 3.12.3-1 [2066 kB]
Get:9 http://ftpmaster.internal/ubuntu noble/main s390x python3.12 s390x 3.12.3-1 [651 kB]
Get:10 http://ftpmaster.internal/ubuntu noble/main s390x libpython3-stdlib s390x 3.12.3-0ubuntu1 [9898 B]
Get:11 http://ftpmaster.internal/ubuntu noble/main s390x python3 s390x 3.12.3-0ubuntu1 [24.1 kB]
Get:12 http://ftpmaster.internal/ubuntu noble/main s390x libelf1t64 s390x 0.190-1.1build4 [69.7 kB]
Get:13 http://ftpmaster.internal/ubuntu noble/main s390x libicu74 s390x 74.2-1ubuntu3 [10.9 MB]
Get:14 http://ftpmaster.internal/ubuntu noble/main s390x libxml2 s390x 2.9.14+dfsg-1.3ubuntu3 [818 kB]
Get:15 http://ftpmaster.internal/ubuntu noble/main s390x libmagic-mgc s390x 1:5.45-3build1 [305 kB]
Get:16 http://ftpmaster.internal/ubuntu noble/main s390x libmagic1t64 s390x 1:5.45-3build1 [93.2 kB]
Get:17 http://ftpmaster.internal/ubuntu noble/main s390x file s390x 1:5.45-3build1 [22.2 kB]
Get:18 http://ftpmaster.internal/ubuntu noble/main s390x gettext-base s390x 0.21-14ubuntu2 [39.4 kB]
Get:19 http://ftpmaster.internal/ubuntu noble/main s390x libuchardet0 s390x 0.0.8-1build1 [76.7 kB]
Get:20 http://ftpmaster.internal/ubuntu noble/main s390x groff-base s390x 1.23.0-3build2 [1049 kB]
Get:21 http://ftpmaster.internal/ubuntu noble/main s390x libncurses6 s390x 6.4+20240113-1ubuntu2 [124 kB]
Get:22 http://ftpmaster.internal/ubuntu noble/main s390x libnghttp2-14 s390x 1.59.0-1build4 [77.9 kB]
Get:23 http://ftpmaster.internal/ubuntu noble/main s390x libpipeline1 s390x 1.5.7-2 [25.0 kB]
Get:24 http://ftpmaster.internal/ubuntu noble/main s390x libpsl5t64 s390x 0.21.2-1.1build1 [57.7 kB]
Get:25 http://ftpmaster.internal/ubuntu noble/main s390x man-db s390x 2.12.0-4build2 [1253 kB]
Get:26 http://ftpmaster.internal/ubuntu noble/main s390x m4 s390x 1.4.19-4build1 [256 kB]
Get:27 http://ftpmaster.internal/ubuntu noble/main s390x autoconf all 2.71-3 [339 kB]
Get:28 http://ftpmaster.internal/ubuntu noble/main s390x autotools-dev all 20220109.1 [44.9 kB]
Get:29 http://ftpmaster.internal/ubuntu noble/main s390x automake all 1:1.16.5-1.3ubuntu1 [558 kB]
Get:30 http://ftpmaster.internal/ubuntu noble/main s390x autopoint all 0.21-14ubuntu2 [422 kB]
Get:31 http://ftpmaster.internal/ubuntu noble/main s390x libdebhelper-perl all 13.14.1ubuntu5 [89.8 kB]
Get:32 http://ftpmaster.internal/ubuntu noble/main s390x libtool all 2.4.7-7build1 [166 kB]
Get:33 http://ftpmaster.internal/ubuntu noble/main s390x dh-autoreconf all 20 [16.1 kB]
Get:34 http://ftpmaster.internal/ubuntu noble/main s390x libarchive-zip-perl all 1.68-1 [90.2 kB]
Get:35 http://ftpmaster.internal/ubuntu noble/main s390x libsub-override-perl all 0.10-1 [10.0 kB]
Get:36 http://ftpmaster.internal/ubuntu noble/main s390x libfile-stripnondeterminism-perl all 1.13.1-1 [18.1 kB]
Get:37 http://ftpmaster.internal/ubuntu noble/main s390x dh-strip-nondeterminism all 1.13.1-1 [5362 B]
Get:38 http://ftpmaster.internal/ubuntu noble/main s390x libdw1t64 s390x 0.190-1.1build4 [286 kB]
Get:39 http://ftpmaster.internal/ubuntu noble/main s390x debugedit s390x 1:5.0-5build2 [50.5 kB]
Get:40 http://ftpmaster.internal/ubuntu noble/main s390x dwz s390x 0.15-1build6 [122 kB]
Get:41 http://ftpmaster.internal/ubuntu noble/main s390x gettext s390x 0.21-14ubuntu2 [915 kB]
Get:42 http://ftpmaster.internal/ubuntu noble/main s390x intltool-debian all 0.35.0+20060710.6 [23.2 kB]
Get:43 http://ftpmaster.internal/ubuntu noble/main s390x po-debconf all 1.0.21+nmu1 [233 kB]
Get:44 http://ftpmaster.internal/ubuntu noble/main s390x debhelper all 13.14.1ubuntu5 [869 kB]
Get:45 http://ftpmaster.internal/ubuntu noble/main s390x fonts-font-awesome all 5.0.10+really4.7.0~dfsg-4.1 [516 kB]
Get:46 http://ftpmaster.internal/ubuntu noble/universe s390x help2man s390x 1.49.3 [201 kB]
Get:47 http://ftpmaster.internal/ubuntu noble/main s390x icu-devtools s390x 74.2-1ubuntu3 [223 kB]
Get:48 http://ftpmaster.internal/ubuntu noble/main s390x libboost1.83-dev s390x 1.83.0-2.1ubuntu3 [10.7 MB]
Get:49 http://ftpmaster.internal/ubuntu noble/main s390x libboost-atomic1.83.0 s390x 1.83.0-2.1ubuntu3 [239 kB]
Get:50 http://ftpmaster.internal/ubuntu noble/main s390x libboost-atomic1.83-dev s390x 1.83.0-2.1ubuntu3 [235 kB]
Get:51 http://ftpmaster.internal/ubuntu noble/main s390x libboost-chrono1.83.0t64 s390x 1.83.0-2.1ubuntu3 [245 kB]
Get:52 http://ftpmaster.internal/ubuntu noble/main s390x libboost-chrono1.83-dev s390x 1.83.0-2.1ubuntu3 [247 kB]
Get:53 http://ftpmaster.internal/ubuntu noble/universe s390x libboost-chrono-dev s390x 1.83.0.1ubuntu2 [4672 B]
Get:54 http://ftpmaster.internal/ubuntu noble/main s390x libboost-filesystem1.83.0 s390x 1.83.0-2.1ubuntu3 [286 kB]
Get:55 http://ftpmaster.internal/ubuntu noble/main s390x libboost-system1.83.0 s390x 1.83.0-2.1ubuntu3 [236 kB]
Get:56 http://ftpmaster.internal/ubuntu noble/main s390x libboost-system1.83-dev s390x 1.83.0-2.1ubuntu3 [231 kB]
Get:57 http://ftpmaster.internal/ubuntu noble/universe s390x libboost-filesystem1.83-dev s390x 1.83.0-2.1ubuntu3 [305 kB]
Get:58 http://ftpmaster.internal/ubuntu noble/universe s390x libboost-filesystem-dev s390x 1.83.0.1ubuntu2 [4096 B]
Get:59 http://ftpmaster.internal/ubuntu noble/main s390x libboost-regex1.83.0 s390x 1.83.0-2.1ubuntu3 [352 kB]
Get:60 http://ftpmaster.internal/ubuntu noble/main s390x libicu-dev s390x 74.2-1ubuntu3 [11.9 MB]
Get:61 http://ftpmaster.internal/ubuntu noble/main s390x libboost-regex1.83-dev s390x 1.83.0-2.1ubuntu3 [374 kB]
Get:62 http://ftpmaster.internal/ubuntu noble/main s390x libboost-iostreams1.83.0 s390x 1.83.0-2.1ubuntu3 [259 kB]
Get:63 http://ftpmaster.internal/ubuntu noble/universe s390x libboost-iostreams1.83-dev s390x 1.83.0-2.1ubuntu3 [264 kB]
Get:64 http://ftpmaster.internal/ubuntu noble/universe s390x libboost-iostreams-dev s390x 1.83.0.1ubuntu2 [4048 B]
Get:65 http://ftpmaster.internal/ubuntu noble/universe s390x libboost-system-dev s390x 1.83.0.1ubuntu2 [4206 B]
Get:66 http://ftpmaster.internal/ubuntu noble/main s390x libbrotli1 s390x 1.1.0-2build2 [375 kB]
Get:67 http://ftpmaster.internal/ubuntu noble/main s390x libsasl2-modules-db s390x 2.1.28+dfsg1-5ubuntu3 [21.3 kB]
Get:68 http://ftpmaster.internal/ubuntu noble/main s390x libsasl2-2 s390x 2.1.28+dfsg1-5ubuntu3 [57.8 kB]
Get:69 http://ftpmaster.internal/ubuntu noble/main s390x libldap2 s390x 2.6.7+dfsg-1~exp1ubuntu8 [203 kB]
Get:70 http://ftpmaster.internal/ubuntu noble/main s390x librtmp1 s390x 2.4+20151223.gitfa8646d.1-2build7 [58.4 kB]
Get:71 http://ftpmaster.internal/ubuntu noble/main s390x libssh-4 s390x 0.10.6-2build2 [189 kB]
Get:72 http://ftpmaster.internal/ubuntu noble/main s390x libcurl3t64-gnutls s390x 8.5.0-2ubuntu10 [356 kB]
Get:73 http://ftpmaster.internal/ubuntu noble/main s390x libcurl4-gnutls-dev s390x 8.5.0-2ubuntu10 [466 kB]
Get:74 http://ftpmaster.internal/ubuntu noble/main s390x libdeflate0 s390x 1.19-1build1 [46.1 kB]
Get:75 http://ftpmaster.internal/ubuntu noble/main s390x libdeflate-dev s390x 1.19-1build1 [52.4 kB]
Get:76 http://ftpmaster.internal/ubuntu noble/universe s390x libhtscodecs2 s390x 1.6.0-1build1 [87.0 kB]
Get:77 http://ftpmaster.internal/ubuntu noble/universe s390x libhts3t64 s390x 1.19+ds-1.1build3 [474 kB]
Get:78 http://ftpmaster.internal/ubuntu noble/main s390x liblzma-dev s390x 5.6.1+really5.4.5-1 [184 kB]
Get:79 http://ftpmaster.internal/ubuntu noble/main s390x zlib1g-dev s390x 1:1.3.dfsg-3.1ubuntu2 [904 kB]
Get:80 http://ftpmaster.internal/ubuntu noble/universe s390x libhts-dev s390x 1.19+ds-1.1build3 [5962 kB]
Get:81 http://ftpmaster.internal/ubuntu noble/main s390x libjs-jquery all 3.6.1+dfsg+~3.5.14-1 [328 kB]
Get:82 http://ftpmaster.internal/ubuntu noble/universe s390x libjs-jquery-datatables all 1.11.5+dfsg-2 [146 kB]
Get:83 http://ftpmaster.internal/ubuntu noble/universe s390x libjs-jquery-datatables-extensions all 0.0+git20150910.28fd64e+dfsg-5 [648 kB]
Get:84 http://ftpmaster.internal/ubuntu noble/main s390x libncurses-dev s390x 6.4+20240113-1ubuntu2 [412 kB]
Get:85 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-array all 3.2.0+~cs5.0.6-2 [45.1 kB]
Get:86 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-axis all 1.0.12+~1.0.16-1 [14.1 kB]
Get:87 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-dispatch all 1.0.6+~1.0.9-1 [9774 B]
Get:88 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-selection all 1.4.1+~1.4.3-1 [42.8 kB]
Get:89 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-drag all 1.2.5+~1.2.5-1 [19.1 kB]
Get:90 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-color all 1.4.1+~1.4.2-1 [19.9 kB]
Get:91 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-interpolate all 1.4.0+~1.4.2-1 [24.0 kB]
Get:92 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-ease all 1.0.7+~1.0.11-1 [12.5 kB]
Get:93 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-timer all 1.0.10+~1.0.10-1 [10.6 kB]
Get:94 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-transition all 1.3.2+~1.3.2-1 [28.7 kB]
Get:95 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-brush all 1.1.6+~1.1.5-1 [181 kB]
Get:96 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-path all 1.0.9+~1.0.9-1 [10.5 kB]
Get:97 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-chord all 1.0.6+~1.0.11-1 [14.2 kB]
Get:98 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-collection all 1.0.7+~1.0.10-1 [17.2 kB]
Get:99 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-contour all 1.3.2+~1.3.3-1 [17.7 kB]
Get:100 http://ftpmaster.internal/ubuntu noble/universe s390x node-safe-buffer all 5.2.1+~cs2.1.2-3 [15.8 kB]
Get:101 http://ftpmaster.internal/ubuntu noble/universe s390x node-iconv-lite all 0.6.3-3 [158 kB]
Get:102 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-queue all 3.0.7-13 [10.2 kB]
Get:103 http://ftpmaster.internal/ubuntu noble/universe s390x node-rw all 1.3.3-5 [7570 B]
Get:104 http://ftpmaster.internal/ubuntu noble/universe s390x node-commander all 9.4.1-1 [50.6 kB]
Get:105 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-dsv all 1.2.0+~1.2.3-1 [17.7 kB]
Get:106 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-fetch all 1.2.0+~1.2.2-1 [10.1 kB]
Get:107 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-quadtree all 1.0.7+~1.0.9-1 [16.6 kB]
Get:108 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-force all 2.1.1+~2.1.4-1 [30.9 kB]
Get:109 http://ftpmaster.internal/ubuntu noble/universe s390x libjs-d3-format all 1:1.4.5+~1.4.2-2 [18.2 kB]
Get:110 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-format all 1:1.4.5+~1.4.2-2 [11.1 kB]
Get:111 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-geo all 1.12.1+~1.12.4-1 [67.3 kB]
Get:112 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-hierarchy all 1.1.9+~1.1.8-1 [35.1 kB]
Get:113 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-polygon all 1.0.6+~1.0.8-1 [8744 B]
Get:114 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-random all 1.1.2+~1.1.3-1 [9140 B]
Get:115 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-time all 1.1.0+~1.1.1-1 [19.2 kB]
Get:116 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-time-format all 2.3.0+~2.3.1-1 [23.8 kB]
Get:117 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-scale all 2.2.2+~2.2.6-1 [43.4 kB]
Get:118 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-scale-chromatic all 1.5.0+~1.5.1-1 [23.5 kB]
Get:119 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-shape all 1.3.7+~1.3.8-1 [56.0 kB]
Get:120 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-voronoi all 1.1.4+~1.1.9-1 [20.5 kB]
Get:121 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3-zoom all 1.8.3+~1.8.4-1 [27.2 kB]
Get:122 http://ftpmaster.internal/ubuntu noble/universe s390x node-d3 all 5.16.0+~cs5.28.10-2 [197 kB]
Get:123 http://ftpmaster.internal/ubuntu noble/universe s390x node-normalize.css all 8.0.1-5 [10.8 kB]
Preconfiguring packages ...
Fetched 64.9 MB in 5s (14.1 MB/s)
Selecting previously unselected package libpython3.12-minimal:s390x.
(Reading database ... 16559 files and directories currently installed.)
Preparing to unpack .../libpython3.12-minimal_3.12.3-1_s390x.deb ...
Unpacking libpython3.12-minimal:s390x (3.12.3-1) ...
Selecting previously unselected package libexpat1:s390x.
Preparing to unpack .../libexpat1_2.6.1-2build1_s390x.deb ...
Unpacking libexpat1:s390x (2.6.1-2build1) ...
Selecting previously unselected package python3.12-minimal.
Preparing to unpack .../python3.12-minimal_3.12.3-1_s390x.deb ...
Unpacking python3.12-minimal (3.12.3-1) ...
Setting up libpython3.12-minimal:s390x (3.12.3-1) ...
Setting up libexpat1:s390x (2.6.1-2build1) ...
Setting up python3.12-minimal (3.12.3-1) ...
Selecting previously unselected package python3-minimal.
(Reading database ... 16877 files and directories currently installed.)
Preparing to unpack .../0-python3-minimal_3.12.3-0ubuntu1_s390x.deb ...
Unpacking python3-minimal (3.12.3-0ubuntu1) ...
Selecting previously unselected package media-types.
Preparing to unpack .../1-media-types_10.1.0_all.deb ...
Unpacking media-types (10.1.0) ...
Selecting previously unselected package netbase.
Preparing to unpack .../2-netbase_6.4_all.deb ...
Unpacking netbase (6.4) ...
Selecting previously unselected package libpython3.12-stdlib:s390x.
Preparing to unpack .../3-libpython3.12-stdlib_3.12.3-1_s390x.deb ...
Unpacking libpython3.12-stdlib:s390x (3.12.3-1) ...
Selecting previously unselected package python3.12.
Preparing to unpack .../4-python3.12_3.12.3-1_s390x.deb ...
Unpacking python3.12 (3.12.3-1) ...
Selecting previously unselected package libpython3-stdlib:s390x.
Preparing to unpack .../5-libpython3-stdlib_3.12.3-0ubuntu1_s390x.deb ...
Unpacking libpython3-stdlib:s390x (3.12.3-0ubuntu1) ...
Setting up python3-minimal (3.12.3-0ubuntu1) ...
Selecting previously unselected package python3.
(Reading database ... 17318 files and directories currently installed.)
Preparing to unpack .../000-python3_3.12.3-0ubuntu1_s390x.deb ...
Unpacking python3 (3.12.3-0ubuntu1) ...
Selecting previously unselected package libelf1t64:s390x.
Preparing to unpack .../001-libelf1t64_0.190-1.1build4_s390x.deb ...
Unpacking libelf1t64:s390x (0.190-1.1build4) ...
Selecting previously unselected package libicu74:s390x.
Preparing to unpack .../002-libicu74_74.2-1ubuntu3_s390x.deb ...
Unpacking libicu74:s390x (74.2-1ubuntu3) ...
Selecting previously unselected package libxml2:s390x.
Preparing to unpack .../003-libxml2_2.9.14+dfsg-1.3ubuntu3_s390x.deb ...
Unpacking libxml2:s390x (2.9.14+dfsg-1.3ubuntu3) ...
Selecting previously unselected package libmagic-mgc.
Preparing to unpack .../004-libmagic-mgc_1%3a5.45-3build1_s390x.deb ...
Unpacking libmagic-mgc (1:5.45-3build1) ...
Selecting previously unselected package libmagic1t64:s390x.
Preparing to unpack .../005-libmagic1t64_1%3a5.45-3build1_s390x.deb ...
Unpacking libmagic1t64:s390x (1:5.45-3build1) ...
Selecting previously unselected package file.
Preparing to unpack .../006-file_1%3a5.45-3build1_s390x.deb ...
Unpacking file (1:5.45-3build1) ...
Selecting previously unselected package gettext-base.
Preparing to unpack .../007-gettext-base_0.21-14ubuntu2_s390x.deb ...
Unpacking gettext-base (0.21-14ubuntu2) ...
Selecting previously unselected package libuchardet0:s390x.
Preparing to unpack .../008-libuchardet0_0.0.8-1build1_s390x.deb ...
Unpacking libuchardet0:s390x (0.0.8-1build1) ...
Selecting previously unselected package groff-base.
Preparing to unpack .../009-groff-base_1.23.0-3build2_s390x.deb ...
Unpacking groff-base (1.23.0-3build2) ...
Selecting previously unselected package libncurses6:s390x.
Preparing to unpack .../010-libncurses6_6.4+20240113-1ubuntu2_s390x.deb ...
Unpacking libncurses6:s390x (6.4+20240113-1ubuntu2) ...
Selecting previously unselected package libnghttp2-14:s390x.
Preparing to unpack .../011-libnghttp2-14_1.59.0-1build4_s390x.deb ...
Unpacking libnghttp2-14:s390x (1.59.0-1build4) ...
Selecting previously unselected package libpipeline1:s390x.
Preparing to unpack .../012-libpipeline1_1.5.7-2_s390x.deb ...
Unpacking libpipeline1:s390x (1.5.7-2) ...
Selecting previously unselected package libpsl5t64:s390x.
Preparing to unpack .../013-libpsl5t64_0.21.2-1.1build1_s390x.deb ...
Unpacking libpsl5t64:s390x (0.21.2-1.1build1) ...
Selecting previously unselected package man-db.
Preparing to unpack .../014-man-db_2.12.0-4build2_s390x.deb ...
Unpacking man-db (2.12.0-4build2) ...
Selecting previously unselected package m4.
Preparing to unpack .../015-m4_1.4.19-4build1_s390x.deb ...
Unpacking m4 (1.4.19-4build1) ...
Selecting previously unselected package autoconf.
Preparing to unpack .../016-autoconf_2.71-3_all.deb ...
Unpacking autoconf (2.71-3) ...
Selecting previously unselected package autotools-dev.
Preparing to unpack .../017-autotools-dev_20220109.1_all.deb ...
Unpacking autotools-dev (20220109.1) ...
Selecting previously unselected package automake.
Preparing to unpack .../018-automake_1%3a1.16.5-1.3ubuntu1_all.deb ...
Unpacking automake (1:1.16.5-1.3ubuntu1) ...
Selecting previously unselected package autopoint.
Preparing to unpack .../019-autopoint_0.21-14ubuntu2_all.deb ...
Unpacking autopoint (0.21-14ubuntu2) ...
Selecting previously unselected package libdebhelper-perl.
Preparing to unpack .../020-libdebhelper-perl_13.14.1ubuntu5_all.deb ...
Unpacking libdebhelper-perl (13.14.1ubuntu5) ...
Selecting previously unselected package libtool.
Preparing to unpack .../021-libtool_2.4.7-7build1_all.deb ...
Unpacking libtool (2.4.7-7build1) ...
Selecting previously unselected package dh-autoreconf.
Preparing to unpack .../022-dh-autoreconf_20_all.deb ...
Unpacking dh-autoreconf (20) ...
Selecting previously unselected package libarchive-zip-perl.
Preparing to unpack .../023-libarchive-zip-perl_1.68-1_all.deb ...
Unpacking libarchive-zip-perl (1.68-1) ...
Selecting previously unselected package libsub-override-perl.
Preparing to unpack .../024-libsub-override-perl_0.10-1_all.deb ...
Unpacking libsub-override-perl (0.10-1) ...
Selecting previously unselected package libfile-stripnondeterminism-perl.
Preparing to unpack .../025-libfile-stripnondeterminism-perl_1.13.1-1_all.deb ...
Unpacking libfile-stripnondeterminism-perl (1.13.1-1) ...
Selecting previously unselected package dh-strip-nondeterminism.
Preparing to unpack .../026-dh-strip-nondeterminism_1.13.1-1_all.deb ...
Unpacking dh-strip-nondeterminism (1.13.1-1) ...
Selecting previously unselected package libdw1t64:s390x.
Preparing to unpack .../027-libdw1t64_0.190-1.1build4_s390x.deb ...
Unpacking libdw1t64:s390x (0.190-1.1build4) ...
Selecting previously unselected package debugedit.
Preparing to unpack .../028-debugedit_1%3a5.0-5build2_s390x.deb ...
Unpacking debugedit (1:5.0-5build2) ...
Selecting previously unselected package dwz.
Preparing to unpack .../029-dwz_0.15-1build6_s390x.deb ...
Unpacking dwz (0.15-1build6) ...
Selecting previously unselected package gettext.
Preparing to unpack .../030-gettext_0.21-14ubuntu2_s390x.deb ...
Unpacking gettext (0.21-14ubuntu2) ...
Selecting previously unselected package intltool-debian.
Preparing to unpack .../031-intltool-debian_0.35.0+20060710.6_all.deb ...
Unpacking intltool-debian (0.35.0+20060710.6) ...
Selecting previously unselected package po-debconf.
Preparing to unpack .../032-po-debconf_1.0.21+nmu1_all.deb ...
Unpacking po-debconf (1.0.21+nmu1) ...
Selecting previously unselected package debhelper.
Preparing to unpack .../033-debhelper_13.14.1ubuntu5_all.deb ...
Unpacking debhelper (13.14.1ubuntu5) ...
Selecting previously unselected package fonts-font-awesome.
Preparing to unpack .../034-fonts-font-awesome_5.0.10+really4.7.0~dfsg-4.1_all.deb ...
Unpacking fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ...
Selecting previously unselected package help2man.
Preparing to unpack .../035-help2man_1.49.3_s390x.deb ...
Unpacking help2man (1.49.3) ...
Selecting previously unselected package icu-devtools.
Preparing to unpack .../036-icu-devtools_74.2-1ubuntu3_s390x.deb ...
Unpacking icu-devtools (74.2-1ubuntu3) ...
Selecting previously unselected package libboost1.83-dev:s390x.
Preparing to unpack .../037-libboost1.83-dev_1.83.0-2.1ubuntu3_s390x.deb ...
Unpacking libboost1.83-dev:s390x (1.83.0-2.1ubuntu3) ...
Selecting previously unselected package libboost-atomic1.83.0:s390x.
Preparing to unpack .../038-libboost-atomic1.83.0_1.83.0-2.1ubuntu3_s390x.deb ...
Unpacking libboost-atomic1.83.0:s390x (1.83.0-2.1ubuntu3) ...
Selecting previously unselected package libboost-atomic1.83-dev:s390x.
Preparing to unpack .../039-libboost-atomic1.83-dev_1.83.0-2.1ubuntu3_s390x.deb ...
Unpacking libboost-atomic1.83-dev:s390x (1.83.0-2.1ubuntu3) ...
Selecting previously unselected package libboost-chrono1.83.0t64:s390x.
Preparing to unpack .../040-libboost-chrono1.83.0t64_1.83.0-2.1ubuntu3_s390x.deb ...
Unpacking libboost-chrono1.83.0t64:s390x (1.83.0-2.1ubuntu3) ...
Selecting previously unselected package libboost-chrono1.83-dev:s390x.
Preparing to unpack .../041-libboost-chrono1.83-dev_1.83.0-2.1ubuntu3_s390x.deb ...
Unpacking libboost-chrono1.83-dev:s390x (1.83.0-2.1ubuntu3) ...
Selecting previously unselected package libboost-chrono-dev:s390x.
Preparing to unpack .../042-libboost-chrono-dev_1.83.0.1ubuntu2_s390x.deb ...
Unpacking libboost-chrono-dev:s390x (1.83.0.1ubuntu2) ...
Selecting previously unselected package libboost-filesystem1.83.0:s390x.
Preparing to unpack .../043-libboost-filesystem1.83.0_1.83.0-2.1ubuntu3_s390x.deb ...
Unpacking libboost-filesystem1.83.0:s390x (1.83.0-2.1ubuntu3) ...
Selecting previously unselected package libboost-system1.83.0:s390x.
Preparing to unpack .../044-libboost-system1.83.0_1.83.0-2.1ubuntu3_s390x.deb ...
Unpacking libboost-system1.83.0:s390x (1.83.0-2.1ubuntu3) ...
Selecting previously unselected package libboost-system1.83-dev:s390x.
Preparing to unpack .../045-libboost-system1.83-dev_1.83.0-2.1ubuntu3_s390x.deb ...
Unpacking libboost-system1.83-dev:s390x (1.83.0-2.1ubuntu3) ...
Selecting previously unselected package libboost-filesystem1.83-dev:s390x.
Preparing to unpack .../046-libboost-filesystem1.83-dev_1.83.0-2.1ubuntu3_s390x.deb ...
Unpacking libboost-filesystem1.83-dev:s390x (1.83.0-2.1ubuntu3) ...
Selecting previously unselected package libboost-filesystem-dev:s390x.
Preparing to unpack .../047-libboost-filesystem-dev_1.83.0.1ubuntu2_s390x.deb ...
Unpacking libboost-filesystem-dev:s390x (1.83.0.1ubuntu2) ...
Selecting previously unselected package libboost-regex1.83.0:s390x.
Preparing to unpack .../048-libboost-regex1.83.0_1.83.0-2.1ubuntu3_s390x.deb ...
Unpacking libboost-regex1.83.0:s390x (1.83.0-2.1ubuntu3) ...
Selecting previously unselected package libicu-dev:s390x.
Preparing to unpack .../049-libicu-dev_74.2-1ubuntu3_s390x.deb ...
Unpacking libicu-dev:s390x (74.2-1ubuntu3) ...
Selecting previously unselected package libboost-regex1.83-dev:s390x.
Preparing to unpack .../050-libboost-regex1.83-dev_1.83.0-2.1ubuntu3_s390x.deb ...
Unpacking libboost-regex1.83-dev:s390x (1.83.0-2.1ubuntu3) ...
Selecting previously unselected package libboost-iostreams1.83.0:s390x.
Preparing to unpack .../051-libboost-iostreams1.83.0_1.83.0-2.1ubuntu3_s390x.deb ...
Unpacking libboost-iostreams1.83.0:s390x (1.83.0-2.1ubuntu3) ...
Selecting previously unselected package libboost-iostreams1.83-dev:s390x.
Preparing to unpack .../052-libboost-iostreams1.83-dev_1.83.0-2.1ubuntu3_s390x.deb ...
Unpacking libboost-iostreams1.83-dev:s390x (1.83.0-2.1ubuntu3) ...
Selecting previously unselected package libboost-iostreams-dev:s390x.
Preparing to unpack .../053-libboost-iostreams-dev_1.83.0.1ubuntu2_s390x.deb ...
Unpacking libboost-iostreams-dev:s390x (1.83.0.1ubuntu2) ...
Selecting previously unselected package libboost-system-dev:s390x.
Preparing to unpack .../054-libboost-system-dev_1.83.0.1ubuntu2_s390x.deb ...
Unpacking libboost-system-dev:s390x (1.83.0.1ubuntu2) ...
Selecting previously unselected package libbrotli1:s390x.
Preparing to unpack .../055-libbrotli1_1.1.0-2build2_s390x.deb ...
Unpacking libbrotli1:s390x (1.1.0-2build2) ...
Selecting previously unselected package libsasl2-modules-db:s390x.
Preparing to unpack .../056-libsasl2-modules-db_2.1.28+dfsg1-5ubuntu3_s390x.deb ...
Unpacking libsasl2-modules-db:s390x (2.1.28+dfsg1-5ubuntu3) ...
Selecting previously unselected package libsasl2-2:s390x.
Preparing to unpack .../057-libsasl2-2_2.1.28+dfsg1-5ubuntu3_s390x.deb ...
Unpacking libsasl2-2:s390x (2.1.28+dfsg1-5ubuntu3) ...
Selecting previously unselected package libldap2:s390x.
Preparing to unpack .../058-libldap2_2.6.7+dfsg-1~exp1ubuntu8_s390x.deb ...
Unpacking libldap2:s390x (2.6.7+dfsg-1~exp1ubuntu8) ...
Selecting previously unselected package librtmp1:s390x.
Preparing to unpack .../059-librtmp1_2.4+20151223.gitfa8646d.1-2build7_s390x.deb ...
Unpacking librtmp1:s390x (2.4+20151223.gitfa8646d.1-2build7) ...
Selecting previously unselected package libssh-4:s390x.
Preparing to unpack .../060-libssh-4_0.10.6-2build2_s390x.deb ...
Unpacking libssh-4:s390x (0.10.6-2build2) ...
Selecting previously unselected package libcurl3t64-gnutls:s390x.
Preparing to unpack .../061-libcurl3t64-gnutls_8.5.0-2ubuntu10_s390x.deb ...
Unpacking libcurl3t64-gnutls:s390x (8.5.0-2ubuntu10) ...
Selecting previously unselected package libcurl4-gnutls-dev:s390x.
Preparing to unpack .../062-libcurl4-gnutls-dev_8.5.0-2ubuntu10_s390x.deb ...
Unpacking libcurl4-gnutls-dev:s390x (8.5.0-2ubuntu10) ...
Selecting previously unselected package libdeflate0:s390x.
Preparing to unpack .../063-libdeflate0_1.19-1build1_s390x.deb ...
Unpacking libdeflate0:s390x (1.19-1build1) ...
Selecting previously unselected package libdeflate-dev:s390x.
Preparing to unpack .../064-libdeflate-dev_1.19-1build1_s390x.deb ...
Unpacking libdeflate-dev:s390x (1.19-1build1) ...
Selecting previously unselected package libhtscodecs2:s390x.
Preparing to unpack .../065-libhtscodecs2_1.6.0-1build1_s390x.deb ...
Unpacking libhtscodecs2:s390x (1.6.0-1build1) ...
Selecting previously unselected package libhts3t64:s390x.
Preparing to unpack .../066-libhts3t64_1.19+ds-1.1build3_s390x.deb ...
Unpacking libhts3t64:s390x (1.19+ds-1.1build3) ...
Selecting previously unselected package liblzma-dev:s390x.
Preparing to unpack .../067-liblzma-dev_5.6.1+really5.4.5-1_s390x.deb ...
Unpacking liblzma-dev:s390x (5.6.1+really5.4.5-1) ...
Selecting previously unselected package zlib1g-dev:s390x.
Preparing to unpack .../068-zlib1g-dev_1%3a1.3.dfsg-3.1ubuntu2_s390x.deb ...
Unpacking zlib1g-dev:s390x (1:1.3.dfsg-3.1ubuntu2) ...
Selecting previously unselected package libhts-dev:s390x.
Preparing to unpack .../069-libhts-dev_1.19+ds-1.1build3_s390x.deb ...
Unpacking libhts-dev:s390x (1.19+ds-1.1build3) ...
Selecting previously unselected package libjs-jquery.
Preparing to unpack .../070-libjs-jquery_3.6.1+dfsg+~3.5.14-1_all.deb ...
Unpacking libjs-jquery (3.6.1+dfsg+~3.5.14-1) ...
Selecting previously unselected package libjs-jquery-datatables.
Preparing to unpack .../071-libjs-jquery-datatables_1.11.5+dfsg-2_all.deb ...
Unpacking libjs-jquery-datatables (1.11.5+dfsg-2) ...
Selecting previously unselected package libjs-jquery-datatables-extensions.
Preparing to unpack .../072-libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-5_all.deb ...
Unpacking libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ...
Selecting previously unselected package libncurses-dev:s390x.
Preparing to unpack .../073-libncurses-dev_6.4+20240113-1ubuntu2_s390x.deb ...
Unpacking libncurses-dev:s390x (6.4+20240113-1ubuntu2) ...
Selecting previously unselected package node-d3-array.
Preparing to unpack .../074-node-d3-array_3.2.0+~cs5.0.6-2_all.deb ...
Unpacking node-d3-array (3.2.0+~cs5.0.6-2) ...
Selecting previously unselected package node-d3-axis.
Preparing to unpack .../075-node-d3-axis_1.0.12+~1.0.16-1_all.deb ...
Unpacking node-d3-axis (1.0.12+~1.0.16-1) ...
Selecting previously unselected package node-d3-dispatch.
Preparing to unpack .../076-node-d3-dispatch_1.0.6+~1.0.9-1_all.deb ...
Unpacking node-d3-dispatch (1.0.6+~1.0.9-1) ...
Selecting previously unselected package node-d3-selection.
Preparing to unpack .../077-node-d3-selection_1.4.1+~1.4.3-1_all.deb ...
Unpacking node-d3-selection (1.4.1+~1.4.3-1) ...
Selecting previously unselected package node-d3-drag.
Preparing to unpack .../078-node-d3-drag_1.2.5+~1.2.5-1_all.deb ...
Unpacking node-d3-drag (1.2.5+~1.2.5-1) ...
Selecting previously unselected package node-d3-color.
Preparing to unpack .../079-node-d3-color_1.4.1+~1.4.2-1_all.deb ...
Unpacking node-d3-color (1.4.1+~1.4.2-1) ...
Selecting previously unselected package node-d3-interpolate.
Preparing to unpack .../080-node-d3-interpolate_1.4.0+~1.4.2-1_all.deb ...
Unpacking node-d3-interpolate (1.4.0+~1.4.2-1) ...
Selecting previously unselected package node-d3-ease.
Preparing to unpack .../081-node-d3-ease_1.0.7+~1.0.11-1_all.deb ...
Unpacking node-d3-ease (1.0.7+~1.0.11-1) ...
Selecting previously unselected package node-d3-timer.
Preparing to unpack .../082-node-d3-timer_1.0.10+~1.0.10-1_all.deb ...
Unpacking node-d3-timer (1.0.10+~1.0.10-1) ...
Selecting previously unselected package node-d3-transition.
Preparing to unpack .../083-node-d3-transition_1.3.2+~1.3.2-1_all.deb ...
Unpacking node-d3-transition (1.3.2+~1.3.2-1) ...
Selecting previously unselected package node-d3-brush.
Preparing to unpack .../084-node-d3-brush_1.1.6+~1.1.5-1_all.deb ...
Unpacking node-d3-brush (1.1.6+~1.1.5-1) ...
Selecting previously unselected package node-d3-path.
Preparing to unpack .../085-node-d3-path_1.0.9+~1.0.9-1_all.deb ...
Unpacking node-d3-path (1.0.9+~1.0.9-1) ...
Selecting previously unselected package node-d3-chord.
Preparing to unpack .../086-node-d3-chord_1.0.6+~1.0.11-1_all.deb ...
Unpacking node-d3-chord (1.0.6+~1.0.11-1) ...
Selecting previously unselected package node-d3-collection.
Preparing to unpack .../087-node-d3-collection_1.0.7+~1.0.10-1_all.deb ...
Unpacking node-d3-collection (1.0.7+~1.0.10-1) ...
Selecting previously unselected package node-d3-contour.
Preparing to unpack .../088-node-d3-contour_1.3.2+~1.3.3-1_all.deb ...
Unpacking node-d3-contour (1.3.2+~1.3.3-1) ...
Selecting previously unselected package node-safe-buffer.
Preparing to unpack .../089-node-safe-buffer_5.2.1+~cs2.1.2-3_all.deb ...
Unpacking node-safe-buffer (5.2.1+~cs2.1.2-3) ...
Selecting previously unselected package node-iconv-lite.
Preparing to unpack .../090-node-iconv-lite_0.6.3-3_all.deb ...
Unpacking node-iconv-lite (0.6.3-3) ...
Selecting previously unselected package node-d3-queue.
Preparing to unpack .../091-node-d3-queue_3.0.7-13_all.deb ...
Unpacking node-d3-queue (3.0.7-13) ...
Selecting previously unselected package node-rw.
Preparing to unpack .../092-node-rw_1.3.3-5_all.deb ...
Unpacking node-rw (1.3.3-5) ...
Selecting previously unselected package node-commander.
Preparing to unpack .../093-node-commander_9.4.1-1_all.deb ...
Unpacking node-commander (9.4.1-1) ...
Selecting previously unselected package node-d3-dsv.
Preparing to unpack .../094-node-d3-dsv_1.2.0+~1.2.3-1_all.deb ...
Unpacking node-d3-dsv (1.2.0+~1.2.3-1) ...
Selecting previously unselected package node-d3-fetch.
Preparing to unpack .../095-node-d3-fetch_1.2.0+~1.2.2-1_all.deb ...
Unpacking node-d3-fetch (1.2.0+~1.2.2-1) ...
Selecting previously unselected package node-d3-quadtree.
Preparing to unpack .../096-node-d3-quadtree_1.0.7+~1.0.9-1_all.deb ...
Unpacking node-d3-quadtree (1.0.7+~1.0.9-1) ...
Selecting previously unselected package node-d3-force.
Preparing to unpack .../097-node-d3-force_2.1.1+~2.1.4-1_all.deb ...
Unpacking node-d3-force (2.1.1+~2.1.4-1) ...
Selecting previously unselected package libjs-d3-format.
Preparing to unpack .../098-libjs-d3-format_1%3a1.4.5+~1.4.2-2_all.deb ...
Unpacking libjs-d3-format (1:1.4.5+~1.4.2-2) ...
Selecting previously unselected package node-d3-format.
Preparing to unpack .../099-node-d3-format_1%3a1.4.5+~1.4.2-2_all.deb ...
Unpacking node-d3-format (1:1.4.5+~1.4.2-2) ...
Selecting previously unselected package node-d3-geo.
Preparing to unpack .../100-node-d3-geo_1.12.1+~1.12.4-1_all.deb ...
Unpacking node-d3-geo (1.12.1+~1.12.4-1) ...
Selecting previously unselected package node-d3-hierarchy.
Preparing to unpack .../101-node-d3-hierarchy_1.1.9+~1.1.8-1_all.deb ...
Unpacking node-d3-hierarchy (1.1.9+~1.1.8-1) ...
Selecting previously unselected package node-d3-polygon.
Preparing to unpack .../102-node-d3-polygon_1.0.6+~1.0.8-1_all.deb ...
Unpacking node-d3-polygon (1.0.6+~1.0.8-1) ...
Selecting previously unselected package node-d3-random.
Preparing to unpack .../103-node-d3-random_1.1.2+~1.1.3-1_all.deb ...
Unpacking node-d3-random (1.1.2+~1.1.3-1) ...
Selecting previously unselected package node-d3-time.
Preparing to unpack .../104-node-d3-time_1.1.0+~1.1.1-1_all.deb ...
Unpacking node-d3-time (1.1.0+~1.1.1-1) ...
Selecting previously unselected package node-d3-time-format.
Preparing to unpack .../105-node-d3-time-format_2.3.0+~2.3.1-1_all.deb ...
Unpacking node-d3-time-format (2.3.0+~2.3.1-1) ...
Selecting previously unselected package node-d3-scale.
Preparing to unpack .../106-node-d3-scale_2.2.2+~2.2.6-1_all.deb ...
Unpacking node-d3-scale (2.2.2+~2.2.6-1) ...
Selecting previously unselected package node-d3-scale-chromatic.
Preparing to unpack .../107-node-d3-scale-chromatic_1.5.0+~1.5.1-1_all.deb ...
Unpacking node-d3-scale-chromatic (1.5.0+~1.5.1-1) ...
Selecting previously unselected package node-d3-shape.
Preparing to unpack .../108-node-d3-shape_1.3.7+~1.3.8-1_all.deb ...
Unpacking node-d3-shape (1.3.7+~1.3.8-1) ...
Selecting previously unselected package node-d3-voronoi.
Preparing to unpack .../109-node-d3-voronoi_1.1.4+~1.1.9-1_all.deb ...
Unpacking node-d3-voronoi (1.1.4+~1.1.9-1) ...
Selecting previously unselected package node-d3-zoom.
Preparing to unpack .../110-node-d3-zoom_1.8.3+~1.8.4-1_all.deb ...
Unpacking node-d3-zoom (1.8.3+~1.8.4-1) ...
Selecting previously unselected package node-d3.
Preparing to unpack .../111-node-d3_5.16.0+~cs5.28.10-2_all.deb ...
Unpacking node-d3 (5.16.0+~cs5.28.10-2) ...
Selecting previously unselected package node-normalize.css.
Preparing to unpack .../112-node-normalize.css_8.0.1-5_all.deb ...
Unpacking node-normalize.css (8.0.1-5) ...
Selecting previously unselected package sbuild-build-depends-main-dummy.
Preparing to unpack .../113-sbuild-build-depends-main-dummy_0.invalid.0_s390x.deb ...
Unpacking sbuild-build-depends-main-dummy (0.invalid.0) ...
Setting up libhtscodecs2:s390x (1.6.0-1build1) ...
Setting up media-types (10.1.0) ...
Setting up libpipeline1:s390x (1.5.7-2) ...
Setting up node-d3-timer (1.0.10+~1.0.10-1) ...
Setting up node-d3-color (1.4.1+~1.4.2-1) ...
Setting up libboost1.83-dev:s390x (1.83.0-2.1ubuntu3) ...
Setting up node-d3-interpolate (1.4.0+~1.4.2-1) ...
Setting up node-d3-queue (3.0.7-13) ...
Setting up node-d3-hierarchy (1.1.9+~1.1.8-1) ...
Setting up node-d3-ease (1.0.7+~1.0.11-1) ...
Setting up libmagic-mgc (1:5.45-3build1) ...
Setting up libarchive-zip-perl (1.68-1) ...
Setting up node-d3-scale-chromatic (1.5.0+~1.5.1-1) ...
Setting up libboost-regex1.83.0:s390x (1.83.0-2.1ubuntu3) ...
Setting up libdebhelper-perl (13.14.1ubuntu5) ...
Setting up libbrotli1:s390x (1.1.0-2build2) ...
Setting up libboost-system1.83.0:s390x (1.83.0-2.1ubuntu3) ...
Setting up libmagic1t64:s390x (1:5.45-3build1) ...
Setting up libpsl5t64:s390x (0.21.2-1.1build1) ...
Setting up libnghttp2-14:s390x (1.59.0-1build4) ...
Setting up libdeflate0:s390x (1.19-1build1) ...
Setting up gettext-base (0.21-14ubuntu2) ...
Setting up m4 (1.4.19-4build1) ...
Setting up node-d3-selection (1.4.1+~1.4.3-1) ...
Setting up node-d3-axis (1.0.12+~1.0.16-1) ...
Setting up file (1:5.45-3build1) ...
Setting up libboost-filesystem1.83.0:s390x (1.83.0-2.1ubuntu3) ...
Setting up node-d3-path (1.0.9+~1.0.9-1) ...
Setting up libelf1t64:s390x (0.190-1.1build4) ...
Setting up libdw1t64:s390x (0.190-1.1build4) ...
Setting up libsasl2-modules-db:s390x (2.1.28+dfsg1-5ubuntu3) ...
Setting up libboost-atomic1.83.0:s390x (1.83.0-2.1ubuntu3) ...
Setting up help2man (1.49.3) ...
Setting up autotools-dev (20220109.1) ...
Setting up node-safe-buffer (5.2.1+~cs2.1.2-3) ...
Setting up node-rw (1.3.3-5) ...
Setting up node-d3-polygon (1.0.6+~1.0.8-1) ...
Setting up node-d3-quadtree (1.0.7+~1.0.9-1) ...
Setting up libboost-chrono1.83.0t64:s390x (1.83.0-2.1ubuntu3) ...
Setting up librtmp1:s390x (2.4+20151223.gitfa8646d.1-2build7) ...
Setting up libboost-iostreams1.83.0:s390x (1.83.0-2.1ubuntu3) ...
Setting up libncurses6:s390x (6.4+20240113-1ubuntu2) ...
Setting up node-d3-collection (1.0.7+~1.0.10-1) ...
Setting up autopoint (0.21-14ubuntu2) ...
Setting up libsasl2-2:s390x (2.1.28+dfsg1-5ubuntu3) ...
Setting up libssh-4:s390x (0.10.6-2build2) ...
Setting up libboost-atomic1.83-dev:s390x (1.83.0-2.1ubuntu3) ...
Setting up autoconf (2.71-3) ...
Setting up node-d3-voronoi (1.1.4+~1.1.9-1) ...
Setting up node-d3-dispatch (1.0.6+~1.0.9-1) ...
Setting up node-d3-time (1.1.0+~1.1.1-1) ...
Setting up liblzma-dev:s390x (5.6.1+really5.4.5-1) ...
Setting up libicu74:s390x (74.2-1ubuntu3) ...
Setting up zlib1g-dev:s390x (1:1.3.dfsg-3.1ubuntu2) ...
Setting up node-commander (9.4.1-1) ...
Setting up dwz (0.15-1build6) ...
Setting up node-d3-array (3.2.0+~cs5.0.6-2) ...
Setting up libjs-d3-format (1:1.4.5+~1.4.2-2) ...
Setting up libuchardet0:s390x (0.0.8-1build1) ...
Setting up debugedit (1:5.0-5build2) ...
Setting up libsub-override-perl (0.10-1) ...
Setting up netbase (6.4) ...
Setting up libboost-system1.83-dev:s390x (1.83.0-2.1ubuntu3) ...
Setting up libjs-jquery (3.6.1+dfsg+~3.5.14-1) ...
Setting up node-d3-geo (1.12.1+~1.12.4-1) ...
Setting up libdeflate-dev:s390x (1.19-1build1) ...
Setting up node-normalize.css (8.0.1-5) ...
Setting up node-d3-transition (1.3.2+~1.3.2-1) ...
Setting up libxml2:s390x (2.9.14+dfsg-1.3ubuntu3) ...
Setting up fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ...
Setting up libldap2:s390x (2.6.7+dfsg-1~exp1ubuntu8) ...
Setting up node-d3-random (1.1.2+~1.1.3-1) ...
Setting up libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ...
Setting up automake (1:1.16.5-1.3ubuntu1) ...
update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode
Setting up libfile-stripnondeterminism-perl (1.13.1-1) ...
Setting up libncurses-dev:s390x (6.4+20240113-1ubuntu2) ...
Setting up gettext (0.21-14ubuntu2) ...
Setting up node-d3-format (1:1.4.5+~1.4.2-2) ...
Setting up libboost-chrono1.83-dev:s390x (1.83.0-2.1ubuntu3) ...
Setting up libpython3.12-stdlib:s390x (3.12.3-1) ...
Setting up libtool (2.4.7-7build1) ...
Setting up libboost-chrono-dev:s390x (1.83.0.1ubuntu2) ...
Setting up node-d3-time-format (2.3.0+~2.3.1-1) ...
Setting up python3.12 (3.12.3-1) ...
Setting up libboost-system-dev:s390x (1.83.0.1ubuntu2) ...
Setting up node-d3-chord (1.0.6+~1.0.11-1) ...
Setting up libcurl3t64-gnutls:s390x (8.5.0-2ubuntu10) ...
Setting up libboost-filesystem1.83-dev:s390x (1.83.0-2.1ubuntu3) ...
Setting up libcurl4-gnutls-dev:s390x (8.5.0-2ubuntu10) ...
Setting up node-d3-shape (1.3.7+~1.3.8-1) ...
Setting up libjs-jquery-datatables (1.11.5+dfsg-2) ...
Setting up intltool-debian (0.35.0+20060710.6) ...
Setting up dh-autoreconf (20) ...
Setting up node-d3-drag (1.2.5+~1.2.5-1) ...
Setting up node-iconv-lite (0.6.3-3) ...
Setting up node-d3-scale (2.2.2+~2.2.6-1) ...
Setting up icu-devtools (74.2-1ubuntu3) ...
Setting up node-d3-force (2.1.1+~2.1.4-1) ...
Setting up node-d3-contour (1.3.2+~1.3.3-1) ...
Setting up dh-strip-nondeterminism (1.13.1-1) ...
Setting up node-d3-brush (1.1.6+~1.1.5-1) ...
Setting up groff-base (1.23.0-3build2) ...
Setting up libhts3t64:s390x (1.19+ds-1.1build3) ...
Setting up node-d3-dsv (1.2.0+~1.2.3-1) ...
Setting up libicu-dev:s390x (74.2-1ubuntu3) ...
Setting up libboost-filesystem-dev:s390x (1.83.0.1ubuntu2) ...
Setting up libpython3-stdlib:s390x (3.12.3-0ubuntu1) ...
Setting up node-d3-zoom (1.8.3+~1.8.4-1) ...
Setting up po-debconf (1.0.21+nmu1) ...
Setting up libhts-dev:s390x (1.19+ds-1.1build3) ...
Setting up node-d3-fetch (1.2.0+~1.2.2-1) ...
Setting up python3 (3.12.3-0ubuntu1) ...
Setting up node-d3 (5.16.0+~cs5.28.10-2) ...
Setting up man-db (2.12.0-4build2) ...
Not building database; man-db/auto-update is not 'true'.
Created symlink /etc/systemd/system/timers.target.wants/man-db.timer → /usr/lib/systemd/system/man-db.timer.
Setting up libboost-regex1.83-dev:s390x (1.83.0-2.1ubuntu3) ...
Setting up libboost-iostreams1.83-dev:s390x (1.83.0-2.1ubuntu3) ...
Setting up debhelper (13.14.1ubuntu5) ...
Setting up libboost-iostreams-dev:s390x (1.83.0.1ubuntu2) ...
Setting up sbuild-build-depends-main-dummy (0.invalid.0) ...
Processing triggers for systemd (255.4-1ubuntu8) ...
Processing triggers for libc-bin (2.39-0ubuntu8) ...

+------------------------------------------------------------------------------+
| Check architectures                                                          |
+------------------------------------------------------------------------------+

Arch check ok (s390x included in any)

+------------------------------------------------------------------------------+
| Build environment                                                            |
+------------------------------------------------------------------------------+

Kernel: Linux 5.4.0-182-generic #202-Ubuntu SMP Fri Apr 26 12:29:12 UTC 2024 s390x (s390x)
Toolchain package versions: binutils_2.42-4ubuntu2 dpkg-dev_1.22.6ubuntu6 g++-13_13.2.0-24ubuntu1 g++-14_14-20240429-1ubuntu1 gcc-13_13.2.0-24ubuntu1 gcc-14_14-20240429-1ubuntu1 libc6-dev_2.39-0ubuntu8 libstdc++-13-dev_13.2.0-24ubuntu1 libstdc++-14-dev_14-20240429-1ubuntu1 libstdc++6_14-20240429-1ubuntu1 linux-libc-dev_6.8.0-31.31
Package versions: adduser_3.137ubuntu1 advancecomp_2.5-1build1 apt_2.7.14build2 apt-utils_2.7.14build2 autoconf_2.71-3 automake_1:1.16.5-1.3ubuntu1 autopoint_0.21-14ubuntu2 autotools-dev_20220109.1 base-files_13ubuntu10 base-passwd_3.6.3build1 bash_5.2.21-2ubuntu4 bash-completion_1:2.11-8 binutils_2.42-4ubuntu2 binutils-common_2.42-4ubuntu2 binutils-s390x-linux-gnu_2.42-4ubuntu2 bsdextrautils_2.39.3-9ubuntu6 bsdutils_1:2.39.3-9ubuntu6 build-essential_12.10ubuntu1 bzip2_1.0.8-5.1 ca-certificates_20240203 coreutils_9.4-3ubuntu6 cpp_4:14-20240120-6ubuntu1 cpp-13_13.2.0-24ubuntu1 cpp-13-s390x-linux-gnu_13.2.0-24ubuntu1 cpp-14_14-20240429-1ubuntu1 cpp-14-s390x-linux-gnu_14-20240429-1ubuntu1 cpp-s390x-linux-gnu_4:14-20240120-6ubuntu1 dash_0.5.12-6ubuntu5 debconf_1.5.86ubuntu1 debconf-i18n_1.5.86ubuntu1 debhelper_13.14.1ubuntu5 debianutils_5.17build1 debugedit_1:5.0-5build2 dh-autoreconf_20 dh-strip-nondeterminism_1.13.1-1 diffutils_1:3.10-1build1 dpkg_1.22.6ubuntu6 dpkg-dev_1.22.6ubuntu6 dwz_0.15-1build6 e2fsprogs_1.47.0-2.4~exp1ubuntu4 fakeroot_1.33-1 file_1:5.45-3build1 findutils_4.9.0-5build1 fonts-font-awesome_5.0.10+really4.7.0~dfsg-4.1 g++_4:14-20240120-6ubuntu1 g++-13_13.2.0-24ubuntu1 g++-13-s390x-linux-gnu_13.2.0-24ubuntu1 g++-14_14-20240429-1ubuntu1 g++-14-s390x-linux-gnu_14-20240429-1ubuntu1 g++-s390x-linux-gnu_4:14-20240120-6ubuntu1 gcc_4:14-20240120-6ubuntu1 gcc-13_13.2.0-24ubuntu1 gcc-13-base_13.2.0-24ubuntu1 gcc-13-s390x-linux-gnu_13.2.0-24ubuntu1 gcc-14_14-20240429-1ubuntu1 gcc-14-base_14-20240429-1ubuntu1 gcc-14-s390x-linux-gnu_14-20240429-1ubuntu1 gcc-s390x-linux-gnu_4:14-20240120-6ubuntu1 gettext_0.21-14ubuntu2 gettext-base_0.21-14ubuntu2 gpg_2.4.4-2ubuntu17 gpg-agent_2.4.4-2ubuntu17 gpgconf_2.4.4-2ubuntu17 gpgv_2.4.4-2ubuntu17 grep_3.11-4build1 groff-base_1.23.0-3build2 gzip_1.12-1ubuntu3 help2man_1.49.3 hostname_3.23+nmu2ubuntu2 icu-devtools_74.2-1ubuntu3 init_1.66ubuntu1 init-system-helpers_1.66ubuntu1 intltool-debian_0.35.0+20060710.6 krb5-locales_1.20.1-6ubuntu2 libacl1_2.3.2-1build1 libapparmor1_4.0.0-beta3-0ubuntu3 libapt-pkg6.0t64_2.7.14build2 libarchive-zip-perl_1.68-1 libargon2-1_0~20190702+dfsg-4build1 libasan8_14-20240429-1ubuntu1 libassuan0_2.5.6-1build1 libatomic1_14-20240429-1ubuntu1 libattr1_1:2.5.2-1build1 libaudit-common_1:3.1.2-2.1build1 libaudit1_1:3.1.2-2.1build1 libbinutils_2.42-4ubuntu2 libblkid1_2.39.3-9ubuntu6 libboost-atomic1.83-dev_1.83.0-2.1ubuntu3 libboost-atomic1.83.0_1.83.0-2.1ubuntu3 libboost-chrono-dev_1.83.0.1ubuntu2 libboost-chrono1.83-dev_1.83.0-2.1ubuntu3 libboost-chrono1.83.0t64_1.83.0-2.1ubuntu3 libboost-filesystem-dev_1.83.0.1ubuntu2 libboost-filesystem1.83-dev_1.83.0-2.1ubuntu3 libboost-filesystem1.83.0_1.83.0-2.1ubuntu3 libboost-iostreams-dev_1.83.0.1ubuntu2 libboost-iostreams1.83-dev_1.83.0-2.1ubuntu3 libboost-iostreams1.83.0_1.83.0-2.1ubuntu3 libboost-regex1.83-dev_1.83.0-2.1ubuntu3 libboost-regex1.83.0_1.83.0-2.1ubuntu3 libboost-system-dev_1.83.0.1ubuntu2 libboost-system1.83-dev_1.83.0-2.1ubuntu3 libboost-system1.83.0_1.83.0-2.1ubuntu3 libboost1.83-dev_1.83.0-2.1ubuntu3 libbrotli1_1.1.0-2build2 libbz2-1.0_1.0.8-5.1 libc-bin_2.39-0ubuntu8 libc-dev-bin_2.39-0ubuntu8 libc6_2.39-0ubuntu8 libc6-dev_2.39-0ubuntu8 libcap-ng0_0.8.4-2build2 libcap2_1:2.66-5ubuntu2 libcc1-0_14-20240429-1ubuntu1 libcom-err2_1.47.0-2.4~exp1ubuntu4 libcrypt-dev_1:4.4.36-4build1 libcrypt1_1:4.4.36-4build1 libcryptsetup12_2:2.7.0-1ubuntu4 libctf-nobfd0_2.42-4ubuntu2 libctf0_2.42-4ubuntu2 libcurl3t64-gnutls_8.5.0-2ubuntu10 libcurl4-gnutls-dev_8.5.0-2ubuntu10 libdb5.3t64_5.3.28+dfsg2-7 libdebconfclient0_0.271ubuntu3 libdebhelper-perl_13.14.1ubuntu5 libdeflate-dev_1.19-1build1 libdeflate0_1.19-1build1 libdevmapper1.02.1_2:1.02.185-3ubuntu3 libdpkg-perl_1.22.6ubuntu6 libdw1t64_0.190-1.1build4 libelf1t64_0.190-1.1build4 libexpat1_2.6.1-2build1 libext2fs2t64_1.47.0-2.4~exp1ubuntu4 libfakeroot_1.33-1 libfdisk1_2.39.3-9ubuntu6 libffi8_3.4.6-1build1 libfile-stripnondeterminism-perl_1.13.1-1 libgcc-13-dev_13.2.0-24ubuntu1 libgcc-14-dev_14-20240429-1ubuntu1 libgcc-s1_14-20240429-1ubuntu1 libgcrypt20_1.10.3-2build1 libgdbm-compat4t64_1.23-5.1build1 libgdbm6t64_1.23-5.1build1 libgmp10_2:6.3.0+dfsg-2ubuntu6 libgnutls30t64_3.8.3-1.1ubuntu3 libgomp1_14-20240429-1ubuntu1 libgpg-error-l10n_1.47-3build2 libgpg-error0_1.47-3build2 libgpm2_1.20.7-11 libgssapi-krb5-2_1.20.1-6ubuntu2 libhogweed6t64_3.9.1-2.2build1 libhts-dev_1.19+ds-1.1build3 libhts3t64_1.19+ds-1.1build3 libhtscodecs2_1.6.0-1build1 libicu-dev_74.2-1ubuntu3 libicu74_74.2-1ubuntu3 libidn2-0_2.3.7-2build1 libip4tc2_1.8.10-3ubuntu2 libisl23_0.26-3build1 libitm1_14-20240429-1ubuntu1 libjansson4_2.14-2build2 libjs-d3-format_1:1.4.5+~1.4.2-2 libjs-jquery_3.6.1+dfsg+~3.5.14-1 libjs-jquery-datatables_1.11.5+dfsg-2 libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-5 libjson-c5_0.17-1build1 libk5crypto3_1.20.1-6ubuntu2 libkeyutils1_1.6.3-3build1 libkmod2_31+20240202-2ubuntu7 libkrb5-3_1.20.1-6ubuntu2 libkrb5support0_1.20.1-6ubuntu2 libldap2_2.6.7+dfsg-1~exp1ubuntu8 liblocale-gettext-perl_1.07-6ubuntu5 liblockfile-bin_1.17-1build3 liblockfile1_1.17-1build3 liblz4-1_1.9.4-1build1 liblzma-dev_5.6.1+really5.4.5-1 liblzma5_5.6.1+really5.4.5-1 libmagic-mgc_1:5.45-3build1 libmagic1t64_1:5.45-3build1 libmd0_1.1.0-2build1 libmount1_2.39.3-9ubuntu6 libmpc3_1.3.1-1build1 libmpfr6_4.2.1-1build1 libncurses-dev_6.4+20240113-1ubuntu2 libncurses6_6.4+20240113-1ubuntu2 libncursesw6_6.4+20240113-1ubuntu2 libnettle8t64_3.9.1-2.2build1 libnghttp2-14_1.59.0-1build4 libnpth0t64_1.6-3.1build1 libnsl-dev_1.3.0-3build3 libnsl2_1.3.0-3build3 libnss-nis_3.1-0ubuntu7 libnss-nisplus_1.3-5build1 libp11-kit0_0.25.3-4ubuntu2 libpam-modules_1.5.3-5ubuntu5 libpam-modules-bin_1.5.3-5ubuntu5 libpam-runtime_1.5.3-5ubuntu5 libpam0g_1.5.3-5ubuntu5 libpcre2-8-0_10.42-4ubuntu2 libperl5.36_5.36.0-9ubuntu1 libperl5.38t64_5.38.2-3.2build2 libpipeline1_1.5.7-2 libpng16-16t64_1.6.43-5build1 libproc2-0_2:4.0.4-4ubuntu3 libpsl5t64_0.21.2-1.1build1 libpython3-stdlib_3.12.3-0ubuntu1 libpython3.12-minimal_3.12.3-1 libpython3.12-stdlib_3.12.3-1 libreadline8t64_8.2-4build1 librtmp1_2.4+20151223.gitfa8646d.1-2build7 libsasl2-2_2.1.28+dfsg1-5ubuntu3 libsasl2-modules-db_2.1.28+dfsg1-5ubuntu3 libseccomp2_2.5.5-1ubuntu3 libselinux1_3.5-2ubuntu2 libsemanage-common_3.5-1build5 libsemanage2_3.5-1build5 libsepol2_3.5-2build1 libsframe1_2.42-4ubuntu2 libsmartcols1_2.39.3-9ubuntu6 libsqlite3-0_3.45.1-1ubuntu2 libss2_1.47.0-2.4~exp1ubuntu4 libssh-4_0.10.6-2build2 libssl3t64_3.0.13-0ubuntu3 libstdc++-13-dev_13.2.0-24ubuntu1 libstdc++-14-dev_14-20240429-1ubuntu1 libstdc++6_14-20240429-1ubuntu1 libsub-override-perl_0.10-1 libsystemd-shared_255.4-1ubuntu8 libsystemd0_255.4-1ubuntu8 libtasn1-6_4.19.0-3build1 libtext-charwidth-perl_0.04-11build3 libtext-iconv-perl_1.7-8build3 libtext-wrapi18n-perl_0.06-10 libtinfo6_6.4+20240113-1ubuntu2 libtirpc-common_1.3.4+ds-1.1build1 libtirpc-dev_1.3.4+ds-1.1build1 libtirpc3t64_1.3.4+ds-1.1build1 libtool_2.4.7-7build1 libubsan1_14-20240429-1ubuntu1 libuchardet0_0.0.8-1build1 libudev1_255.4-1ubuntu8 libunistring2_1.0-2 libunistring5_1.1-2build1 libuuid1_2.39.3-9ubuntu6 libxml2_2.9.14+dfsg-1.3ubuntu3 libxxhash0_0.8.2-2build1 libzstd1_1.5.5+dfsg2-2build1 linux-libc-dev_6.8.0-31.31 lockfile-progs_0.1.19build2 login_1:4.13+dfsg1-4ubuntu3 logsave_1.47.0-2.4~exp1ubuntu4 lto-disabled-list_47 m4_1.4.19-4build1 make_4.3-4.1build2 man-db_2.12.0-4build2 mawk_1.3.4.20240123-1build1 media-types_10.1.0 mount_2.39.3-9ubuntu6 ncurses-base_6.4+20240113-1ubuntu2 ncurses-bin_6.4+20240113-1ubuntu2 netbase_6.4 node-commander_9.4.1-1 node-d3_5.16.0+~cs5.28.10-2 node-d3-array_3.2.0+~cs5.0.6-2 node-d3-axis_1.0.12+~1.0.16-1 node-d3-brush_1.1.6+~1.1.5-1 node-d3-chord_1.0.6+~1.0.11-1 node-d3-collection_1.0.7+~1.0.10-1 node-d3-color_1.4.1+~1.4.2-1 node-d3-contour_1.3.2+~1.3.3-1 node-d3-dispatch_1.0.6+~1.0.9-1 node-d3-drag_1.2.5+~1.2.5-1 node-d3-dsv_1.2.0+~1.2.3-1 node-d3-ease_1.0.7+~1.0.11-1 node-d3-fetch_1.2.0+~1.2.2-1 node-d3-force_2.1.1+~2.1.4-1 node-d3-format_1:1.4.5+~1.4.2-2 node-d3-geo_1.12.1+~1.12.4-1 node-d3-hierarchy_1.1.9+~1.1.8-1 node-d3-interpolate_1.4.0+~1.4.2-1 node-d3-path_1.0.9+~1.0.9-1 node-d3-polygon_1.0.6+~1.0.8-1 node-d3-quadtree_1.0.7+~1.0.9-1 node-d3-queue_3.0.7-13 node-d3-random_1.1.2+~1.1.3-1 node-d3-scale_2.2.2+~2.2.6-1 node-d3-scale-chromatic_1.5.0+~1.5.1-1 node-d3-selection_1.4.1+~1.4.3-1 node-d3-shape_1.3.7+~1.3.8-1 node-d3-time_1.1.0+~1.1.1-1 node-d3-time-format_2.3.0+~2.3.1-1 node-d3-timer_1.0.10+~1.0.10-1 node-d3-transition_1.3.2+~1.3.2-1 node-d3-voronoi_1.1.4+~1.1.9-1 node-d3-zoom_1.8.3+~1.8.4-1 node-iconv-lite_0.6.3-3 node-normalize.css_8.0.1-5 node-rw_1.3.3-5 node-safe-buffer_5.2.1+~cs2.1.2-3 openssl_3.0.13-0ubuntu3 optipng_0.7.8+ds-1build2 passwd_1:4.13+dfsg1-4ubuntu3 patch_2.7.6-7build3 perl_5.38.2-3.2build2 perl-base_5.38.2-3.2build2 perl-modules-5.36_5.36.0-9ubuntu1 perl-modules-5.38_5.38.2-3.2build2 pinentry-curses_1.2.1-3ubuntu5 pkgbinarymangler_154 po-debconf_1.0.21+nmu1 policyrcd-script-zg2_0.1-3.1 procps_2:4.0.4-4ubuntu3 psmisc_23.7-1build1 python3_3.12.3-0ubuntu1 python3-minimal_3.12.3-0ubuntu1 python3.12_3.12.3-1 python3.12-minimal_3.12.3-1 readline-common_8.2-4build1 rpcsvc-proto_1.4.2-0ubuntu7 sbuild-build-depends-main-dummy_0.invalid.0 sed_4.9-2build1 sensible-utils_0.0.22 systemd_255.4-1ubuntu8 systemd-dev_255.4-1ubuntu8 systemd-sysv_255.4-1ubuntu8 sysvinit-utils_3.08-6ubuntu3 tar_1.35+dfsg-3build1 tzdata_2024a-2ubuntu1 ubuntu-keyring_2023.11.28.1 util-linux_2.39.3-9ubuntu6 uuid-runtime_2.39.3-9ubuntu6 xz-utils_5.6.1+really5.4.5-1 zlib1g_1:1.3.dfsg-3.1ubuntu2 zlib1g-dev_1:1.3.dfsg-3.1ubuntu2

+------------------------------------------------------------------------------+
| Build                                                                        |
+------------------------------------------------------------------------------+


Unpack source
-------------

-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA512

Format: 3.0 (quilt)
Source: ataqv
Binary: ataqv
Architecture: any
Version: 1.3.1+ds-2build3
Maintainer: Ubuntu Developers <ubuntu-devel-discuss@lists.ubuntu.com>
Uploaders: Michael R. Crusoe <crusoe@debian.org>
Homepage: https://github.com/ParkerLab/ataqv/
Standards-Version: 4.6.2
Vcs-Browser: https://salsa.debian.org/med-team/ataqv
Vcs-Git: https://salsa.debian.org/med-team/ataqv.git
Testsuite: autopkgtest
Build-Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3, debhelper
Package-List:
 ataqv deb science optional arch=any
Checksums-Sha1:
 d2533715129c79f7bc3e11a9673efedf0348303b 4068080 ataqv_1.3.1+ds.orig.tar.xz
 df4465c726c75ee6aa41437cee51038ffdc58c3c 9604 ataqv_1.3.1+ds-2build3.debian.tar.xz
Checksums-Sha256:
 6e996bb0dfa6b92b17537af20680827fd66f5b91b2f0bb7268bf21ff1cffd939 4068080 ataqv_1.3.1+ds.orig.tar.xz
 a15090d13fa6e595064da033151f021f62c580e3e259b3aada0d011c92b5d191 9604 ataqv_1.3.1+ds-2build3.debian.tar.xz
Files:
 2738a7faf0c6728c73c2b24fb895c2fa 4068080 ataqv_1.3.1+ds.orig.tar.xz
 cf73181f0186aba327a30905f39f8d34 9604 ataqv_1.3.1+ds-2build3.debian.tar.xz
Original-Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>

-----BEGIN PGP SIGNATURE-----

iQIzBAEBCgAdFiEEoIn7Nqr72tWswTJQafeQFxohCYQFAmYKRUMACgkQafeQFxoh
CYTnExAAr3QHYnJfWEUcuH66QYJF1BbqyTQ4PayTnegBxChEdMZoa2DwVklp9iZd
R1e8C5LbddgFnJsXL+moc/1X8D8mjuzWSJtPk8BoPqOFLQ5jKah6omywJA0f7ETc
51VxNfJi4C6SfpZvhlzW9QPa1Oc+1R0BCYq6pGYZS3bmxiHd2ajoX6O0STYSEWwZ
3I9Z1LAO47t0yNNqWMnNXW0kRHvKh6QuWeYYCPHy89nR9VbwAL4yiDlAHcu5eu5o
bhAPz9jKIgWvXn56bAJbWtdPQd/xsxrL/BUVwk9yb5jzmsiHEUCQaZdSclMP1Ejs
GqgsIGnDyLb19xiEHwlcjAdBWxMRJGKq3ZvTR+8asKgGiSgitDT2KAyEE0xZk5W6
RinO1u+JC3RoNI4BTiEI8VjQsuaCtlwIA7+MuaGwghfWTLwzhGRmotxGcngBHDCX
YT3VmmOG2qlwSZeuKEBy0NCvC5r+lCB6l728vm3Floudhriwf8mHv26cGz4+MhSg
ckSBS/mTbA0atDGJrgaqBNDaYfJxXEvIkW8W09wp6KPVCocaWGCjbASSY+B96lwR
X7grxsVSyHGDnO7q3066xOlLL9NJhZcG1gmnb2mqRaOtFCqAy6wjNgduYNVwgSnY
4Hf9Y7EYE+ANjL9xRy1OFDFxn17K0awzE7BRIAfPQ/TtJvKPulI=
=yAg5
-----END PGP SIGNATURE-----

gpgv: Signature made Mon Apr  1 05:25:23 2024 UTC
gpgv:                using RSA key A089FB36AAFBDAD5ACC1325069F790171A210984
gpgv: Can't check signature: No public key
dpkg-source: warning: cannot verify inline signature for ./ataqv_1.3.1+ds-2build3.dsc: no acceptable signature found
dpkg-source: info: extracting ataqv in /<<PKGBUILDDIR>>
dpkg-source: info: unpacking ataqv_1.3.1+ds.orig.tar.xz
dpkg-source: info: unpacking ataqv_1.3.1+ds-2build3.debian.tar.xz
dpkg-source: info: using patch list from debian/patches/series
dpkg-source: info: applying modernize
dpkg-source: info: applying no_cov
dpkg-source: info: applying python3
dpkg-source: info: applying packaged_js
dpkg-source: info: applying spelling
dpkg-source: info: applying clean_less
dpkg-source: info: applying reproducible_build

Check disk space
----------------

Sufficient free space for build

User Environment
----------------

APT_CONFIG=/var/lib/sbuild/apt.conf
DEB_BUILD_OPTIONS=noautodbgsym parallel=4
HOME=/sbuild-nonexistent
LANG=C.UTF-8
LC_ALL=C.UTF-8
LOGNAME=buildd
PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games
SCHROOT_ALIAS_NAME=build-PACKAGEBUILD-28294924
SCHROOT_CHROOT_NAME=build-PACKAGEBUILD-28294924
SCHROOT_COMMAND=env
SCHROOT_GID=2501
SCHROOT_GROUP=buildd
SCHROOT_SESSION_ID=build-PACKAGEBUILD-28294924
SCHROOT_UID=2001
SCHROOT_USER=buildd
SHELL=/bin/sh
TERM=unknown
USER=buildd
V=1

dpkg-buildpackage
-----------------

Command: dpkg-buildpackage -us -uc -mLaunchpad Build Daemon <buildd@bos02-s390x-011.buildd> -B -rfakeroot
dpkg-buildpackage: info: source package ataqv
dpkg-buildpackage: info: source version 1.3.1+ds-2build3
dpkg-buildpackage: info: source distribution noble
 dpkg-source --before-build .
dpkg-buildpackage: info: host architecture s390x
 debian/rules clean
dh clean
   dh_auto_clean
	make -j4 clean
make[1]: Entering directory '/<<PKGBUILDDIR>>'
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
   dh_clean
 debian/rules binary-arch
dh binary-arch
   dh_update_autotools_config -a
   dh_autoreconf -a
   debian/rules override_dh_auto_configure
make[1]: Entering directory '/<<PKGBUILDDIR>>'
cp -sf /usr/share/nodejs/d3/dist/d3.min.js src/web/js/d3.min.js
cp -sf /usr/share/javascript/jquery-datatables-extensions/JSZip/jszip.min.js src/web/js/jszip.min.js
cp -sf /usr/share/javascript/jquery-datatables-extensions/Buttons/css/buttons.dataTables.min.css src/web/css/datatables.buttons.min.css
cp -sf /usr/share/javascript/jquery-datatables/css/jquery.dataTables.min.css src/web/css/datatables.min.css
cp -sf /usr/share/fonts-font-awesome/css/font-awesome.min.css src/web/css/font-awesome.min.css
cp -sf /usr/share/javascript/normalize.css/normalize.css src/web/css/normalize.css
cp -sf /usr/share/fonts-font-awesome/fonts/* src/web/fonts/
cp -s /usr/share/javascript/jquery/jquery.min.js \
	/usr/share/javascript/jquery-datatables-extensions/pdfmake/build/pdfmake.min.js \
	/usr/share/javascript/jquery-datatables/jquery.dataTables.min.js \
	/usr/share/javascript/jquery-datatables-extensions/Buttons/js/dataTables.buttons.min.js \
	/usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.colVis.min.js \
	/usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.html5.min.js \
	/usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.print.min.js \
	/usr/share/javascript/jquery-datatables-extensions/Responsive/js/dataTables.responsive.min.js \
	src/web/js/
rm -f src/web/js/datatables.min.js
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
   debian/rules override_dh_auto_build
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_auto_build -- all testing/run_ataqv_tests
	make -j4 "INSTALL=install --strip-program=true" all testing/run_ataqv_tests
make[2]: Entering directory '/<<PKGBUILDDIR>>'
g++ -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX -o build/ataqv.o -c /<<PKGBUILDDIR>>/src/cpp/ataqv.cpp
g++ -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX -o build/Features.o -c /<<PKGBUILDDIR>>/src/cpp/Features.cpp
g++ -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX -o build/HTS.o -c /<<PKGBUILDDIR>>/src/cpp/HTS.cpp
g++ -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX -o build/IO.o -c /<<PKGBUILDDIR>>/src/cpp/IO.cpp
g++ -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX -o build/Metrics.o -c /<<PKGBUILDDIR>>/src/cpp/Metrics.cpp
g++ -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX -o build/Peaks.o -c /<<PKGBUILDDIR>>/src/cpp/Peaks.cpp
g++ -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX -o build/Utils.o -c /<<PKGBUILDDIR>>/src/cpp/Utils.cpp
g++  -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX   -o testing/run_ataqv_tests.o -c /<<PKGBUILDDIR>>/src/cpp/run_ataqv_tests.cpp
g++  -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX   -o testing/test_features.o -c /<<PKGBUILDDIR>>/src/cpp/test_features.cpp
In file included from /<<PKGBUILDDIR>>/src/cpp/test_features.cpp:1:
/<<PKGBUILDDIR>>/src/cpp/test_features.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____167()’:
/<<PKGBUILDDIR>>/src/cpp/test_features.cpp:171:47: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=]
  171 |     REQUIRE_THROWS_AS(collection.add(f), std::out_of_range);
      |                                               ^~~~~~~~~~~~
g++  -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX   -o testing/test_hts.o -c /<<PKGBUILDDIR>>/src/cpp/test_hts.cpp
In file included from /<<PKGBUILDDIR>>/src/cpp/test_hts.cpp:3:
/<<PKGBUILDDIR>>/src/cpp/test_hts.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____169()’:
/<<PKGBUILDDIR>>/src/cpp/test_hts.cpp:200:57: warning: catching polymorphic type ‘class HTSException’ by value [-Wcatch-value=]
  200 |     REQUIRE_THROWS_AS(record_to_string(header, record), HTSException);
      |                                                         ^~~~~~~~~~~~
g++  -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX   -o testing/test_io.o -c /<<PKGBUILDDIR>>/src/cpp/test_io.cpp
g++  -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX   -o testing/test_metrics.o -c /<<PKGBUILDDIR>>/src/cpp/test_metrics.cpp
g++  -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX   -o testing/test_peaks.o -c /<<PKGBUILDDIR>>/src/cpp/test_peaks.cpp
In file included from /<<PKGBUILDDIR>>/src/cpp/test_peaks.cpp:1:
/<<PKGBUILDDIR>>/src/cpp/test_peaks.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____172()’:
/<<PKGBUILDDIR>>/src/cpp/test_peaks.cpp:181:44: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=]
  181 |     REQUIRE_THROWS_AS(rpc.add(peak3), std::out_of_range);
      |                                            ^~~~~~~~~~~~
In file included from /<<PKGBUILDDIR>>/src/cpp/test_metrics.cpp:3:
/<<PKGBUILDDIR>>/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____170()’:
/<<PKGBUILDDIR>>/src/cpp/test_metrics.cpp:173:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=]
  173 |         REQUIRE_THROWS_AS(collector.load_alignments(), FileException);
      |                                                        ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/cpp/test_metrics.cpp:178:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=]
  178 |         REQUIRE_THROWS_AS(collector.load_alignments(), FileException);
      |                                                        ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____243()’:
/<<PKGBUILDDIR>>/src/cpp/test_metrics.cpp:249:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=]
  249 |     REQUIRE_THROWS_AS(collector.load_alignments(), FileException);
      |                                                    ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____252()’:
/<<PKGBUILDDIR>>/src/cpp/test_metrics.cpp:259:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=]
  259 |     REQUIRE_THROWS_AS(collector.load_alignments(), FileException);
      |                                                    ^~~~~~~~~~~~~
g++  -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX   -o testing/test_utils.o -c /<<PKGBUILDDIR>>/src/cpp/test_utils.cpp
g++  -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX   -o testing/Features.o -c /<<PKGBUILDDIR>>/src/cpp/Features.cpp
g++  -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX   -o testing/HTS.o -c /<<PKGBUILDDIR>>/src/cpp/HTS.cpp
g++  -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX   -o testing/IO.o -c /<<PKGBUILDDIR>>/src/cpp/IO.cpp
g++  -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX   -o testing/Metrics.o -c /<<PKGBUILDDIR>>/src/cpp/Metrics.cpp
g++  -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX   -o testing/Peaks.o -c /<<PKGBUILDDIR>>/src/cpp/Peaks.cpp
g++  -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX   -o testing/Utils.o -c /<<PKGBUILDDIR>>/src/cpp/Utils.cpp
g++ -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX -o build/ataqv build/ataqv.o build/Features.o build/HTS.o build/IO.o build/Metrics.o build/Peaks.o build/Utils.o -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread
g++ -g -O2 -fno-omit-frame-pointer -mbackchain -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -fno-stack-clash-protection -fdebug-prefix-map=/<<PKGBUILDDIR>>=/usr/src/ataqv-1.3.1+ds-2build3 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<<PKGBUILDDIR>>/src/cpp -D LINUX -o testing/run_ataqv_tests testing/run_ataqv_tests.o testing/test_features.o testing/test_hts.o testing/test_io.o testing/test_metrics.o testing/test_peaks.o testing/test_utils.o testing/Features.o testing/HTS.o testing/IO.o testing/Metrics.o testing/Peaks.o testing/Utils.o -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread
make[2]: Leaving directory '/<<PKGBUILDDIR>>'
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
   dh_auto_test -a
	make -j4 test
make[1]: Entering directory '/<<PKGBUILDDIR>>'

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
run_ataqv_tests is a Catch v1.5.7 host application.
Run with -? for options

-------------------------------------------------------------------------------
Test bad HTS record
-------------------------------------------------------------------------------
./src/cpp/test_hts.cpp:169
...............................................................................

./src/cpp/test_hts.cpp:200: FAILED:
  REQUIRE_THROWS_AS( record_to_string(header, record) )
because no exception was thrown where one was expected:

Reading human autosomal references from autosomal_references.gz.
Autosomal references for human:
	I
	II
	III
Reading human autosomal references from autosomal_references.gz.
Autosomal references for human:
	I
	II
	III
Reading human autosomal references from autosomal_references.gz.
Autosomal references for human:
	I
	II
	III
Read 411 excluded regions from exclude.dac.bed.gz.
Read 1649 excluded regions from exclude.duke.bed.gz.
Loading TSS file 'hg19.tss.refseq.bed.gz'.
Excluding TSS [chr11	10530722	10530723	MTRNR2L8	0	-] which overlaps excluded region [chr11	10529403	10531969	Low_mappability_island	1000	.]
Excluding TSS [chr12	118573688	118573689	PEBP1	0	+] which overlaps excluded region [chr12	118573638	118573695	LSU-rRNA_Hsa	1000	.]
Excluding TSS [chr14	105196180	105196181	ADSSL1	0	+] which overlaps excluded region [chr14	105195912	105196275	TAR1	1000	.]
Excluding TSS [chr17	22022436	22022437	MTRNR2L1	0	+] which overlaps excluded region [chr17	22018524	22032049	Low_mappability_island	1000	.]
Excluding TSS [chr20	55934877	55934878	MTRNR2L3	0	-] which overlaps excluded region [chr20	55932703	55936114	chrM	1000	.]
Excluding TSS [chr5	79946853	79946854	MTRNR2L2	0	-] which overlaps excluded region [chr5	79945807	79948223	Low_mappability_island	1000	.]
Excluding TSS [chr6	62284007	62284008	MTRNR2L9	0	+] which overlaps excluded region [chr6	62283966	62284581	Low_mappability_island	1000	.]
Excluding TSS [chr7	57207570	57207571	ZNF479	0	-] which overlaps excluded region [chr7	57205319	57210318	BSR/Beta	1000	.]
Excluding TSS [chr7	63688851	63688852	ZNF679	0	+] which overlaps excluded region [chr7	63686197	63693336	BSR/Beta	1000	.]
Excluding TSS [chr7	142374130	142374131	MTRNR2L6	0	+] which overlaps excluded region [chr7	142372972	142375638	Low_mappability_island	1000	.]
Excluding TSS [chrX	55208943	55208944	MTRNR2L10	0	-] which overlaps excluded region [chrX	55204685	55210460	chrM	1000	.]
Excluding TSS [chrY	25130409	25130410	BPY2B	0	+] which overlaps excluded region [chrY	25122419	25160800	BSR/Beta	1000	.]
Excluding TSS [chrY	26764150	26764151	BPY2B	0	+] which overlaps excluded region [chrY	26756160	26794538	BSR/Beta	1000	.]
Excluding TSS [chrY	27198250	27198251	BPY2B	0	-] which overlaps excluded region [chrY	27167859	27206241	BSR/Beta	1000	.]
chr1 feature count: 2687
chr2 feature count: 1715
chr3 feature count: 1490
chr4 feature count: 1004
chr5 feature count: 1132
chr6 feature count: 1368
chr7 feature count: 1169
chr8 feature count: 913
chr9 feature count: 1025
chr10 feature count: 1039
chr11 feature count: 1642
chr12 feature count: 1350
chr13 feature count: 433
chr14 feature count: 785
chr15 feature count: 812
chr16 feature count: 1106
chr17 feature count: 1528
chr18 feature count: 398
chr19 feature count: 1785
chr20 feature count: 694
chr21 feature count: 321
chr22 feature count: 593
Loaded 24989 TSS in 1.87768 seconds. (13308.4 TSS/second).

Collecting metrics from test.bam.

Logging problematic reads to SRR891275.problems.

Loading peaks for read group SRR891275 from test.peaks.gz.
Excluding peak [chr1	569780	570073	both.broad_peak_1] which overlaps excluded region [chr1	564449	570371	High_Mappability_island	1000	.]
Excluding peak [chr1	5727305	5727512	both.broad_peak_97] which overlaps excluded region [chr1	5725866	5736651	Low_mappability_island	1000	.]
Excluding peak [chr1	16840415	16841121	both.broad_peak_297] which overlaps excluded region [chr1	16839923	16841396	Low_mappability_island	1000	.]
Excluding peak [chr1	121354253	121354849	both.broad_peak_1896] which overlaps excluded region [chr1	121351474	121487059	centromeric_repeat	1000	.]
Excluding peak [chr1	121478396	121478755	both.broad_peak_1897] which overlaps excluded region [chr1	121351474	121487059	centromeric_repeat	1000	.]
Excluding peak [chr1	121484326	121485516	both.broad_peak_1898] which overlaps excluded region [chr1	121351474	121487059	centromeric_repeat	1000	.]
Excluding peak [chr1	142538265	142538603	both.broad_peak_1899] which overlaps excluded region [chr1	142535434	142543081	Satellite_repeat	1000	.]
Excluding peak [chr1	148928074	148928756	both.broad_peak_1971] which overlaps excluded region [chr1	148927799	148928362	TAR1	1000	.]
Excluding peak [chr10	38804202	38804431	both.broad_peak_4296] which overlaps excluded region [chr10	38772277	38819357	Satellite_repeat	1000	.]
Excluding peak [chr10	38817221	38818020	both.broad_peak_4297] which overlaps excluded region [chr10	38772277	38819357	Satellite_repeat	1000	.]
Excluding peak [chr10	38872037	38872278	both.broad_peak_4298] which overlaps excluded region [chr10	38868892	38889025	Satellite_repeat	1000	.]
Excluding peak [chr10	42355450	42355650	both.broad_peak_4299] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42358135	42358433	both.broad_peak_4300] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42364634	42365245	both.broad_peak_4301] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42379790	42380383	both.broad_peak_4302] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42384574	42385679	both.broad_peak_4303] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42392602	42392861	both.broad_peak_4304] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42396775	42396995	both.broad_peak_4305] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42398498	42400769	both.broad_peak_4306] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42404317	42404537	both.broad_peak_4307] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42408166	42408438	both.broad_peak_4308] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42442445	42442676	both.broad_peak_4309] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42527244	42528189	both.broad_peak_4310] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42529217	42530048	both.broad_peak_4311] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42534598	42534872	both.broad_peak_4312] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42596780	42597198	both.broad_peak_4313] which overlaps excluded region [chr10	42596676	42602082	Satellite_repeat	1000	.]
Excluding peak [chr10	42599471	42600289	both.broad_peak_4314] which overlaps excluded region [chr10	42596676	42602082	Satellite_repeat	1000	.]
Excluding peak [chr10	42817448	42818278	both.broad_peak_4315] which overlaps excluded region [chr10	42790522	42818398	Satellite_repeat	1000	.]
Excluding peak [chr11	189746	190314	both.broad_peak_5511] which overlaps excluded region [chr11	189419	190691	TAR1	1000	.]
Excluding peak [chr11	50731852	50732074	both.broad_peak_6138] which overlaps excluded region [chr11	50318471	50784078	centromeric_repeat	1000	.]
Excluding peak [chr11	51572059	51572261	both.broad_peak_6139] which overlaps excluded region [chr11	51567242	51594226	centromeric_repeat	1000	.]
Excluding peak [chr11	51579362	51580694	both.broad_peak_6140] which overlaps excluded region [chr11	51567242	51594226	centromeric_repeat	1000	.]
Excluding peak [chr11	51591018	51591457	both.broad_peak_6141] which overlaps excluded region [chr11	51567242	51594226	centromeric_repeat	1000	.]
Excluding peak [chr11	55006615	55007430	both.broad_peak_6142] which overlaps excluded region [chr11	54694046	55027975	centromeric_repeat	1000	.]
Excluding peak [chr11	73221686	73221937	both.broad_peak_6590] which overlaps excluded region [chr11	73221660	73221946	Low_mappability_island	1000	.]
Excluding peak [chr12	94193	94658	both.broad_peak_7396] which overlaps excluded region [chr12	94147	95158	TAR1	1000	.]
Excluding peak [chr12	34841382	34841617	both.broad_peak_7957] which overlaps excluded region [chr12	34432130	34857010	centromeric_repeat	1000	.]
Excluding peak [chr12	34846246	34846543	both.broad_peak_7958] which overlaps excluded region [chr12	34432130	34857010	centromeric_repeat	1000	.]
Excluding peak [chr12	38008155	38008894	both.broad_peak_7959] which overlaps excluded region [chr12	37989447	38441828	centromeric_repeat	1000	.]
Excluding peak [chr12	38023173	38023373	both.broad_peak_7960] which overlaps excluded region [chr12	37989447	38441828	centromeric_repeat	1000	.]
Excluding peak [chr12	118573678	118574095	both.broad_peak_9235] which overlaps excluded region [chr12	118573638	118573695	LSU-rRNA_Hsa	1000	.]
Excluding peak [chr12	127650467	127651165	both.broad_peak_9421] which overlaps excluded region [chr12	127650407	127651075	LSU-rRNA_Hsa	1000	.]
Excluding peak [chr14	32953483	32953821	both.broad_peak_10712] which overlaps excluded region [chr14	32953263	32954381	Low_mappability_island	1000	.]
Excluding peak [chr15	80444564	80445859	both.broad_peak_12630] which overlaps excluded region [chr15	80445513	80445569	(GAGTG)n	1000	.]
Excluding peak [chr16	60436	61192	both.broad_peak_12924] which overlaps excluded region [chr16	60058	61142	TAR1	1000	.]
Excluding peak [chr16	33866265	33866524	both.broad_peak_13513] which overlaps excluded region [chr16	33864355	34023306	centromeric_repeat	1000	.]
Excluding peak [chr16	33918664	33919304	both.broad_peak_13514] which overlaps excluded region [chr16	33864355	34023306	centromeric_repeat	1000	.]
Excluding peak [chr16	34009313	34009561	both.broad_peak_13515] which overlaps excluded region [chr16	33864355	34023306	centromeric_repeat	1000	.]
Excluding peak [chr16	46386270	46386795	both.broad_peak_13516] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr16	46391235	46392140	both.broad_peak_13517] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr16	46403548	46403849	both.broad_peak_13518] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr16	46416804	46417405	both.broad_peak_13519] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr16	46427429	46427991	both.broad_peak_13520] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr17	22020593	22020916	both.broad_peak_14569] which overlaps excluded region [chr17	22018524	22032049	Low_mappability_island	1000	.]
Excluding peak [chr17	22252084	22253296	both.broad_peak_14570] which overlaps excluded region [chr17	22221073	22263006	centromeric_repeat	1000	.]
Excluding peak [chr17	22261278	22261740	both.broad_peak_14571] which overlaps excluded region [chr17	22221073	22263006	centromeric_repeat	1000	.]
Excluding peak [chr17	25264883	25265249	both.broad_peak_14572] which overlaps excluded region [chr17	25263010	25268059	Satellite_repeat	1000	.]
Excluding peak [chr17	41381728	41382265	both.broad_peak_14950] which overlaps excluded region [chr17	41381502	41382591	High_Mappability_island	1000	.]
Excluding peak [chr17	41465631	41466936	both.broad_peak_14957] which overlaps excluded region [chr17	41465562	41467288	High_Mappability_island	1000	.]
Excluding peak [chr17	51183057	51183341	both.broad_peak_15172] which overlaps excluded region [chr17	51183038	51183763	Low_mappability_island	1000	.]
Excluding peak [chr17	58602907	58603721	both.broad_peak_15290] which overlaps excluded region [chr17	58603715	58603738	(GAGTG)n	1000	.]
Excluding peak [chr18	111564	112042	both.broad_peak_15816] which overlaps excluded region [chr18	105658	112233	Satellite_repeat	1000	.]
Excluding peak [chr18	18512827	18513193	both.broad_peak_16011] which overlaps excluded region [chr18	18510894	18520356	centromeric_repeat	1000	.]
Excluding peak [chr18	18516045	18520399	both.broad_peak_16012] which overlaps excluded region [chr18	18510894	18520356	centromeric_repeat	1000	.]
Excluding peak [chr19	21776802	21777550	both.broad_peak_17342] which overlaps excluded region [chr19	21776132	21780768	BSR/Beta	1000	.]
Excluding peak [chr19	24169382	24170027	both.broad_peak_17364] which overlaps excluded region [chr19	24156856	24171961	BSR/Beta	1000	.]
Excluding peak [chr19	24474565	24474765	both.broad_peak_17369] which overlaps excluded region [chr19	24385474	24633168	centromeric_repeat	1000	.]
Excluding peak [chr19	24526069	24526320	both.broad_peak_17370] which overlaps excluded region [chr19	24385474	24633168	centromeric_repeat	1000	.]
Excluding peak [chr19	27731880	27733339	both.broad_peak_17371] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000	.]
Excluding peak [chr19	27738359	27738668	both.broad_peak_17372] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000	.]
Excluding peak [chr19	27756701	27756901	both.broad_peak_17373] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000	.]
Excluding peak [chr19	27801311	27801531	both.broad_peak_17374] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000	.]
Excluding peak [chr19	37784325	37784692	both.broad_peak_17536] which overlaps excluded region [chr19	37759473	37797722	centromeric_repeat	1000	.]
Excluding peak [chr19	42069917	42070450	both.broad_peak_17680] which overlaps excluded region [chr19	42069989	42071891	LSU-rRNA_Hsa	1000	.]
Excluding peak [chr2	89848588	89848836	both.broad_peak_19338] which overlaps excluded region [chr2	89830421	89880514	Satellite_repeat	1000	.]
Excluding peak [chr2	89872032	89872646	both.broad_peak_19339] which overlaps excluded region [chr2	89830421	89880514	Satellite_repeat	1000	.]
Excluding peak [chr2	89878336	89879257	both.broad_peak_19340] which overlaps excluded region [chr2	89830421	89880514	Satellite_repeat	1000	.]
Excluding peak [chr2	90449580	90449808	both.broad_peak_19342] which overlaps excluded region [chr2	90443001	90545431	Low_mappability_island	1000	.]
Excluding peak [chr2	91847848	91848177	both.broad_peak_19344] which overlaps excluded region [chr2	91847957	91848503	TAR1	1000	.]
Excluding peak [chr2	92272876	92273767	both.broad_peak_19345] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92281197	92281779	both.broad_peak_19346] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92284237	92284462	both.broad_peak_19347] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92290435	92291262	both.broad_peak_19348] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92296588	92297023	both.broad_peak_19349] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92305535	92305892	both.broad_peak_19350] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92317234	92317870	both.broad_peak_19351] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	114361072	114362020	both.broad_peak_19697] which overlaps excluded region [chr2	114361054	114362417	TAR1	1000	.]
Excluding peak [chr2	132559385	132560425	both.broad_peak_19833] which overlaps excluded region [chr2	132560214	132560696	TAR1	1000	.]
Excluding peak [chr2	132996509	132996755	both.broad_peak_19834] which overlaps excluded region [chr2	132994855	133007983	ALR/Alpha	1000	.]
Excluding peak [chr2	149639210	149639450	both.broad_peak_19986] which overlaps excluded region [chr2	149639207	149639515	Low_mappability_island	1000	.]
Excluding peak [chr2	162135291	162136055	both.broad_peak_20150] which overlaps excluded region [chr2	162135000	162139241	Low_mappability_island	1000	.]
Excluding peak [chr20	26269111	26270030	both.broad_peak_21666] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	26278258	26278484	both.broad_peak_21667] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	26289332	26290609	both.broad_peak_21668] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	26305634	26305887	both.broad_peak_21669] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	26317322	26318676	both.broad_peak_21670] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	29512475	29512675	both.broad_peak_21671] which overlaps excluded region [chr20	29511127	29514978	ALR/Alpha	1000	.]
Excluding peak [chr20	29517798	29518922	both.broad_peak_21672] which overlaps excluded region [chr20	29517710	29521147	centromeric_repeat	1000	.]
Excluding peak [chr20	29813756	29813985	both.broad_peak_21678] which overlaps excluded region [chr20	29803876	29833334	centromeric_repeat	1000	.]
Excluding peak [chr20	29831826	29832026	both.broad_peak_21679] which overlaps excluded region [chr20	29803876	29833334	centromeric_repeat	1000	.]
Excluding peak [chr20	62917250	62917592	both.broad_peak_22240] which overlaps excluded region [chr20	62916702	62918053	telomeric_repeat	1000	.]
Excluding peak [chr21	9825749	9827187	both.broad_peak_22241] which overlaps excluded region [chr21	9825451	9827612	High_Mappability_island	1000	.]
Excluding peak [chr21	10773372	10773572	both.broad_peak_22242] which overlaps excluded region [chr21	10697886	10860890	centromeric_repeat	1000	.]
Excluding peak [chr21	11186125	11187338	both.broad_peak_22243] which overlaps excluded region [chr21	11186054	11188131	Satellite_repeat	1000	.]
Excluding peak [chr22	18878342	18878659	both.broad_peak_22759] which overlaps excluded region [chr22	18876789	18884510	Satellite_repeat	1000	.]
Excluding peak [chr22	18879876	18880128	both.broad_peak_22760] which overlaps excluded region [chr22	18876789	18884510	Satellite_repeat	1000	.]
Excluding peak [chr22	18883583	18883799	both.broad_peak_22761] which overlaps excluded region [chr22	18876789	18884510	Satellite_repeat	1000	.]
Excluding peak [chr22	22652231	22653042	both.broad_peak_22847] which overlaps excluded region [chr22	22652105	22652554	TAR1	1000	.]
Excluding peak [chr3	25508907	25509133	both.broad_peak_23723] which overlaps excluded region [chr3	25508897	25509131	Low_mappability_island	1000	.]
Excluding peak [chr3	73159761	73160669	both.broad_peak_24512] which overlaps excluded region [chr3	73159606	73161131	snRNA	1000	.]
Excluding peak [chr3	96336804	96337073	both.broad_peak_24578] which overlaps excluded region [chr3	96335934	96337436	Low_mappability_island	1000	.]
Excluding peak [chr3	196625608	196625808	both.broad_peak_25903] which overlaps excluded region [chr3	196625514	196625860	Satellite_repeat	1000	.]
Excluding peak [chr4	49094768	49094968	both.broad_peak_26437] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000	.]
Excluding peak [chr4	49107449	49107766	both.broad_peak_26438] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000	.]
Excluding peak [chr4	49122928	49123231	both.broad_peak_26439] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000	.]
Excluding peak [chr4	49151102	49151911	both.broad_peak_26440] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000	.]
Excluding peak [chr4	49645060	49645303	both.broad_peak_26441] which overlaps excluded region [chr4	49488472	49662085	centromeric_repeat	1000	.]
Excluding peak [chr4	49659456	49659760	both.broad_peak_26442] which overlaps excluded region [chr4	49488472	49662085	centromeric_repeat	1000	.]
Excluding peak [chr4	56194226	56194485	both.broad_peak_26481] which overlaps excluded region [chr4	56194229	56194584	Low_mappability_island	1000	.]
Excluding peak [chr4	68264592	68266730	both.broad_peak_26530] which overlaps excluded region [chr4	68264186	68266830	centromeric_repeat	1000	.]
Excluding peak [chr4	191032545	191032745	both.broad_peak_27751] which overlaps excluded region [chr4	191026302	191044344	telomeric_repeat	1000	.]
Excluding peak [chr5	46364115	46364315	both.broad_peak_28116] which overlaps excluded region [chr5	45908253	46411114	centromeric_repeat	1000	.]
Excluding peak [chr5	49450550	49450756	both.broad_peak_28117] which overlaps excluded region [chr5	49405493	49554574	centromeric_repeat	1000	.]
Excluding peak [chr5	49547478	49547699	both.broad_peak_28118] which overlaps excluded region [chr5	49405493	49554574	centromeric_repeat	1000	.]
Excluding peak [chr5	134259765	134260404	both.broad_peak_29117] which overlaps excluded region [chr5	134258949	134264271	Low_mappability_island	1000	.]
Excluding peak [chr5	134262625	134262877	both.broad_peak_29118] which overlaps excluded region [chr5	134258949	134264271	Low_mappability_island	1000	.]
Excluding peak [chr6	58776533	58779369	both.broad_peak_30874] which overlaps excluded region [chr6	58745955	58780547	centromeric_repeat	1000	.]
Excluding peak [chr7	43878412	43878832	both.broad_peak_32927] which overlaps excluded region [chr7	43878355	43878530	TAR1	1000	.]
Excluding peak [chr7	45291476	45291676	both.broad_peak_32976] which overlaps excluded region [chr7	45291517	45291740	Low_mappability_island	1000	.]
Excluding peak [chr7	57549361	57549585	both.broad_peak_33054] which overlaps excluded region [chr7	57544726	57556913	Satellite_repeat	1000	.]
Excluding peak [chr7	57957789	57957996	both.broad_peak_33055] which overlaps excluded region [chr7	57939184	58055539	centromeric_repeat	1000	.]
Excluding peak [chr7	61968705	61969761	both.broad_peak_33056] which overlaps excluded region [chr7	61054285	62454680	centromeric_repeat	1000	.]
Excluding peak [chr7	61986136	61986336	both.broad_peak_33057] which overlaps excluded region [chr7	61054285	62454680	centromeric_repeat	1000	.]
Excluding peak [chr7	64099785	64100002	both.broad_peak_33067] which overlaps excluded region [chr7	64090864	64105357	BSR/Beta	1000	.]
Excluding peak [chr7	64100838	64101105	both.broad_peak_33068] which overlaps excluded region [chr7	64090864	64105357	BSR/Beta	1000	.]
Excluding peak [chr7	100550706	100551292	both.broad_peak_33481] which overlaps excluded region [chr7	100550640	100551321	Low_mappability_island	1000	.]
Excluding peak [chr8	43092778	43097038	both.broad_peak_34830] which overlaps excluded region [chr8	43092737	43097573	Satellite_repeat	1000	.]
Excluding peak [chr8	43779474	43779699	both.broad_peak_34831] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000	.]
Excluding peak [chr8	43794100	43794746	both.broad_peak_34832] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000	.]
Excluding peak [chr8	43820539	43820739	both.broad_peak_34833] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000	.]
Excluding peak [chr8	43821992	43822192	both.broad_peak_34834] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000	.]
Excluding peak [chr8	46845309	46845549	both.broad_peak_34835] which overlaps excluded region [chr8	46838215	47457541	centromeric_repeat	1000	.]
Excluding peak [chr8	46852362	46852861	both.broad_peak_34836] which overlaps excluded region [chr8	46838215	47457541	centromeric_repeat	1000	.]
Excluding peak [chr8	100507997	100508253	both.broad_peak_35355] which overlaps excluded region [chr8	100508010	100508287	Low_mappability_island	1000	.]
Excluding peak [chr9	45356920	45357350	both.broad_peak_36413] which overlaps excluded region [chr9	45355954	45357644	telomeric_repeat	1000	.]
Excluding peak [chr9	45439723	45439970	both.broad_peak_36414] which overlaps excluded region [chr9	45435109	45443517	centromeric_repeat	1000	.]
Excluding peak [chr9	45441747	45442443	both.broad_peak_36415] which overlaps excluded region [chr9	45435109	45443517	centromeric_repeat	1000	.]
Excluding peak [chr9	66494045	66494608	both.broad_peak_36419] which overlaps excluded region [chr9	66494170	66494805	TAR1	1000	.]
Excluding peak [chr9	66824178	66824684	both.broad_peak_36421] which overlaps excluded region [chr9	66767710	66864329	centromeric_repeat	1000	.]
Excluding peak [chr9	66833083	66833633	both.broad_peak_36422] which overlaps excluded region [chr9	66767710	66864329	centromeric_repeat	1000	.]
Excluding peak [chr9	67339988	67340844	both.broad_peak_36425] which overlaps excluded region [chr9	67340080	67340661	TAR1	1000	.]
Excluding peak [chr9	68377361	68377574	both.broad_peak_36426] which overlaps excluded region [chr9	68376841	68377466	TAR1	1000	.]
Excluding peak [chr9	68412991	68414393	both.broad_peak_36427] which overlaps excluded region [chr9	68410775	68435115	Low_mappability_island	1000	.]
Excluding peak [chr9	70648541	70648768	both.broad_peak_36436] which overlaps excluded region [chr9	70648394	70648886	TAR1	1000	.]
chr1 peak count: 3667
chr2 peak count: 3154
chr3 peak count: 2528
chr4 peak count: 1814
chr5 peak count: 2042
chr6 peak count: 2483
chr7 peak count: 1999
chr8 peak count: 1647
chr9 peak count: 1475
chr10 peak count: 1815
chr11 peak count: 1878
chr12 peak count: 2078
chr13 peak count: 1026
chr14 peak count: 1275
chr15 peak count: 1140
chr16 peak count: 1211
chr17 peak count: 1664
chr18 peak count: 772
chr19 peak count: 1595
chr20 peak count: 864
chr21 peak count: 487
chr22 peak count: 662
Loaded 37276 peaks in 16.485 seconds. (2261.2 peaks/second).

Logging problematic reads to SRR891278.problems.

Loading peaks for read group SRR891278 from test.peaks.gz.
Excluding peak [chr1	569780	570073	both.broad_peak_1] which overlaps excluded region [chr1	564449	570371	High_Mappability_island	1000	.]
Excluding peak [chr1	5727305	5727512	both.broad_peak_97] which overlaps excluded region [chr1	5725866	5736651	Low_mappability_island	1000	.]
Excluding peak [chr1	16840415	16841121	both.broad_peak_297] which overlaps excluded region [chr1	16839923	16841396	Low_mappability_island	1000	.]
Excluding peak [chr1	121354253	121354849	both.broad_peak_1896] which overlaps excluded region [chr1	121351474	121487059	centromeric_repeat	1000	.]
Excluding peak [chr1	121478396	121478755	both.broad_peak_1897] which overlaps excluded region [chr1	121351474	121487059	centromeric_repeat	1000	.]
Excluding peak [chr1	121484326	121485516	both.broad_peak_1898] which overlaps excluded region [chr1	121351474	121487059	centromeric_repeat	1000	.]
Excluding peak [chr1	142538265	142538603	both.broad_peak_1899] which overlaps excluded region [chr1	142535434	142543081	Satellite_repeat	1000	.]
Excluding peak [chr1	148928074	148928756	both.broad_peak_1971] which overlaps excluded region [chr1	148927799	148928362	TAR1	1000	.]
Excluding peak [chr10	38804202	38804431	both.broad_peak_4296] which overlaps excluded region [chr10	38772277	38819357	Satellite_repeat	1000	.]
Excluding peak [chr10	38817221	38818020	both.broad_peak_4297] which overlaps excluded region [chr10	38772277	38819357	Satellite_repeat	1000	.]
Excluding peak [chr10	38872037	38872278	both.broad_peak_4298] which overlaps excluded region [chr10	38868892	38889025	Satellite_repeat	1000	.]
Excluding peak [chr10	42355450	42355650	both.broad_peak_4299] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42358135	42358433	both.broad_peak_4300] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42364634	42365245	both.broad_peak_4301] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42379790	42380383	both.broad_peak_4302] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42384574	42385679	both.broad_peak_4303] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42392602	42392861	both.broad_peak_4304] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42396775	42396995	both.broad_peak_4305] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42398498	42400769	both.broad_peak_4306] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42404317	42404537	both.broad_peak_4307] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42408166	42408438	both.broad_peak_4308] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42442445	42442676	both.broad_peak_4309] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42527244	42528189	both.broad_peak_4310] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42529217	42530048	both.broad_peak_4311] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42534598	42534872	both.broad_peak_4312] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42596780	42597198	both.broad_peak_4313] which overlaps excluded region [chr10	42596676	42602082	Satellite_repeat	1000	.]
Excluding peak [chr10	42599471	42600289	both.broad_peak_4314] which overlaps excluded region [chr10	42596676	42602082	Satellite_repeat	1000	.]
Excluding peak [chr10	42817448	42818278	both.broad_peak_4315] which overlaps excluded region [chr10	42790522	42818398	Satellite_repeat	1000	.]
Excluding peak [chr11	189746	190314	both.broad_peak_5511] which overlaps excluded region [chr11	189419	190691	TAR1	1000	.]
Excluding peak [chr11	50731852	50732074	both.broad_peak_6138] which overlaps excluded region [chr11	50318471	50784078	centromeric_repeat	1000	.]
Excluding peak [chr11	51572059	51572261	both.broad_peak_6139] which overlaps excluded region [chr11	51567242	51594226	centromeric_repeat	1000	.]
Excluding peak [chr11	51579362	51580694	both.broad_peak_6140] which overlaps excluded region [chr11	51567242	51594226	centromeric_repeat	1000	.]
Excluding peak [chr11	51591018	51591457	both.broad_peak_6141] which overlaps excluded region [chr11	51567242	51594226	centromeric_repeat	1000	.]
Excluding peak [chr11	55006615	55007430	both.broad_peak_6142] which overlaps excluded region [chr11	54694046	55027975	centromeric_repeat	1000	.]
Excluding peak [chr11	73221686	73221937	both.broad_peak_6590] which overlaps excluded region [chr11	73221660	73221946	Low_mappability_island	1000	.]
Excluding peak [chr12	94193	94658	both.broad_peak_7396] which overlaps excluded region [chr12	94147	95158	TAR1	1000	.]
Excluding peak [chr12	34841382	34841617	both.broad_peak_7957] which overlaps excluded region [chr12	34432130	34857010	centromeric_repeat	1000	.]
Excluding peak [chr12	34846246	34846543	both.broad_peak_7958] which overlaps excluded region [chr12	34432130	34857010	centromeric_repeat	1000	.]
Excluding peak [chr12	38008155	38008894	both.broad_peak_7959] which overlaps excluded region [chr12	37989447	38441828	centromeric_repeat	1000	.]
Excluding peak [chr12	38023173	38023373	both.broad_peak_7960] which overlaps excluded region [chr12	37989447	38441828	centromeric_repeat	1000	.]
Excluding peak [chr12	118573678	118574095	both.broad_peak_9235] which overlaps excluded region [chr12	118573638	118573695	LSU-rRNA_Hsa	1000	.]
Excluding peak [chr12	127650467	127651165	both.broad_peak_9421] which overlaps excluded region [chr12	127650407	127651075	LSU-rRNA_Hsa	1000	.]
Excluding peak [chr14	32953483	32953821	both.broad_peak_10712] which overlaps excluded region [chr14	32953263	32954381	Low_mappability_island	1000	.]
Excluding peak [chr15	80444564	80445859	both.broad_peak_12630] which overlaps excluded region [chr15	80445513	80445569	(GAGTG)n	1000	.]
Excluding peak [chr16	60436	61192	both.broad_peak_12924] which overlaps excluded region [chr16	60058	61142	TAR1	1000	.]
Excluding peak [chr16	33866265	33866524	both.broad_peak_13513] which overlaps excluded region [chr16	33864355	34023306	centromeric_repeat	1000	.]
Excluding peak [chr16	33918664	33919304	both.broad_peak_13514] which overlaps excluded region [chr16	33864355	34023306	centromeric_repeat	1000	.]
Excluding peak [chr16	34009313	34009561	both.broad_peak_13515] which overlaps excluded region [chr16	33864355	34023306	centromeric_repeat	1000	.]
Excluding peak [chr16	46386270	46386795	both.broad_peak_13516] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr16	46391235	46392140	both.broad_peak_13517] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr16	46403548	46403849	both.broad_peak_13518] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr16	46416804	46417405	both.broad_peak_13519] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr16	46427429	46427991	both.broad_peak_13520] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr17	22020593	22020916	both.broad_peak_14569] which overlaps excluded region [chr17	22018524	22032049	Low_mappability_island	1000	.]
Excluding peak [chr17	22252084	22253296	both.broad_peak_14570] which overlaps excluded region [chr17	22221073	22263006	centromeric_repeat	1000	.]
Excluding peak [chr17	22261278	22261740	both.broad_peak_14571] which overlaps excluded region [chr17	22221073	22263006	centromeric_repeat	1000	.]
Excluding peak [chr17	25264883	25265249	both.broad_peak_14572] which overlaps excluded region [chr17	25263010	25268059	Satellite_repeat	1000	.]
Excluding peak [chr17	41381728	41382265	both.broad_peak_14950] which overlaps excluded region [chr17	41381502	41382591	High_Mappability_island	1000	.]
Excluding peak [chr17	41465631	41466936	both.broad_peak_14957] which overlaps excluded region [chr17	41465562	41467288	High_Mappability_island	1000	.]
Excluding peak [chr17	51183057	51183341	both.broad_peak_15172] which overlaps excluded region [chr17	51183038	51183763	Low_mappability_island	1000	.]
Excluding peak [chr17	58602907	58603721	both.broad_peak_15290] which overlaps excluded region [chr17	58603715	58603738	(GAGTG)n	1000	.]
Excluding peak [chr18	111564	112042	both.broad_peak_15816] which overlaps excluded region [chr18	105658	112233	Satellite_repeat	1000	.]
Excluding peak [chr18	18512827	18513193	both.broad_peak_16011] which overlaps excluded region [chr18	18510894	18520356	centromeric_repeat	1000	.]
Excluding peak [chr18	18516045	18520399	both.broad_peak_16012] which overlaps excluded region [chr18	18510894	18520356	centromeric_repeat	1000	.]
Excluding peak [chr19	21776802	21777550	both.broad_peak_17342] which overlaps excluded region [chr19	21776132	21780768	BSR/Beta	1000	.]
Excluding peak [chr19	24169382	24170027	both.broad_peak_17364] which overlaps excluded region [chr19	24156856	24171961	BSR/Beta	1000	.]
Excluding peak [chr19	24474565	24474765	both.broad_peak_17369] which overlaps excluded region [chr19	24385474	24633168	centromeric_repeat	1000	.]
Excluding peak [chr19	24526069	24526320	both.broad_peak_17370] which overlaps excluded region [chr19	24385474	24633168	centromeric_repeat	1000	.]
Excluding peak [chr19	27731880	27733339	both.broad_peak_17371] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000	.]
Excluding peak [chr19	27738359	27738668	both.broad_peak_17372] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000	.]
Excluding peak [chr19	27756701	27756901	both.broad_peak_17373] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000	.]
Excluding peak [chr19	27801311	27801531	both.broad_peak_17374] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000	.]
Excluding peak [chr19	37784325	37784692	both.broad_peak_17536] which overlaps excluded region [chr19	37759473	37797722	centromeric_repeat	1000	.]
Excluding peak [chr19	42069917	42070450	both.broad_peak_17680] which overlaps excluded region [chr19	42069989	42071891	LSU-rRNA_Hsa	1000	.]
Excluding peak [chr2	89848588	89848836	both.broad_peak_19338] which overlaps excluded region [chr2	89830421	89880514	Satellite_repeat	1000	.]
Excluding peak [chr2	89872032	89872646	both.broad_peak_19339] which overlaps excluded region [chr2	89830421	89880514	Satellite_repeat	1000	.]
Excluding peak [chr2	89878336	89879257	both.broad_peak_19340] which overlaps excluded region [chr2	89830421	89880514	Satellite_repeat	1000	.]
Excluding peak [chr2	90449580	90449808	both.broad_peak_19342] which overlaps excluded region [chr2	90443001	90545431	Low_mappability_island	1000	.]
Excluding peak [chr2	91847848	91848177	both.broad_peak_19344] which overlaps excluded region [chr2	91847957	91848503	TAR1	1000	.]
Excluding peak [chr2	92272876	92273767	both.broad_peak_19345] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92281197	92281779	both.broad_peak_19346] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92284237	92284462	both.broad_peak_19347] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92290435	92291262	both.broad_peak_19348] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92296588	92297023	both.broad_peak_19349] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92305535	92305892	both.broad_peak_19350] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92317234	92317870	both.broad_peak_19351] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	114361072	114362020	both.broad_peak_19697] which overlaps excluded region [chr2	114361054	114362417	TAR1	1000	.]
Excluding peak [chr2	132559385	132560425	both.broad_peak_19833] which overlaps excluded region [chr2	132560214	132560696	TAR1	1000	.]
Excluding peak [chr2	132996509	132996755	both.broad_peak_19834] which overlaps excluded region [chr2	132994855	133007983	ALR/Alpha	1000	.]
Excluding peak [chr2	149639210	149639450	both.broad_peak_19986] which overlaps excluded region [chr2	149639207	149639515	Low_mappability_island	1000	.]
Excluding peak [chr2	162135291	162136055	both.broad_peak_20150] which overlaps excluded region [chr2	162135000	162139241	Low_mappability_island	1000	.]
Excluding peak [chr20	26269111	26270030	both.broad_peak_21666] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	26278258	26278484	both.broad_peak_21667] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	26289332	26290609	both.broad_peak_21668] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	26305634	26305887	both.broad_peak_21669] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	26317322	26318676	both.broad_peak_21670] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	29512475	29512675	both.broad_peak_21671] which overlaps excluded region [chr20	29511127	29514978	ALR/Alpha	1000	.]
Excluding peak [chr20	29517798	29518922	both.broad_peak_21672] which overlaps excluded region [chr20	29517710	29521147	centromeric_repeat	1000	.]
Excluding peak [chr20	29813756	29813985	both.broad_peak_21678] which overlaps excluded region [chr20	29803876	29833334	centromeric_repeat	1000	.]
Excluding peak [chr20	29831826	29832026	both.broad_peak_21679] which overlaps excluded region [chr20	29803876	29833334	centromeric_repeat	1000	.]
Excluding peak [chr20	62917250	62917592	both.broad_peak_22240] which overlaps excluded region [chr20	62916702	62918053	telomeric_repeat	1000	.]
Excluding peak [chr21	9825749	9827187	both.broad_peak_22241] which overlaps excluded region [chr21	9825451	9827612	High_Mappability_island	1000	.]
Excluding peak [chr21	10773372	10773572	both.broad_peak_22242] which overlaps excluded region [chr21	10697886	10860890	centromeric_repeat	1000	.]
Excluding peak [chr21	11186125	11187338	both.broad_peak_22243] which overlaps excluded region [chr21	11186054	11188131	Satellite_repeat	1000	.]
Excluding peak [chr22	18878342	18878659	both.broad_peak_22759] which overlaps excluded region [chr22	18876789	18884510	Satellite_repeat	1000	.]
Excluding peak [chr22	18879876	18880128	both.broad_peak_22760] which overlaps excluded region [chr22	18876789	18884510	Satellite_repeat	1000	.]
Excluding peak [chr22	18883583	18883799	both.broad_peak_22761] which overlaps excluded region [chr22	18876789	18884510	Satellite_repeat	1000	.]
Excluding peak [chr22	22652231	22653042	both.broad_peak_22847] which overlaps excluded region [chr22	22652105	22652554	TAR1	1000	.]
Excluding peak [chr3	25508907	25509133	both.broad_peak_23723] which overlaps excluded region [chr3	25508897	25509131	Low_mappability_island	1000	.]
Excluding peak [chr3	73159761	73160669	both.broad_peak_24512] which overlaps excluded region [chr3	73159606	73161131	snRNA	1000	.]
Excluding peak [chr3	96336804	96337073	both.broad_peak_24578] which overlaps excluded region [chr3	96335934	96337436	Low_mappability_island	1000	.]
Excluding peak [chr3	196625608	196625808	both.broad_peak_25903] which overlaps excluded region [chr3	196625514	196625860	Satellite_repeat	1000	.]
Excluding peak [chr4	49094768	49094968	both.broad_peak_26437] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000	.]
Excluding peak [chr4	49107449	49107766	both.broad_peak_26438] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000	.]
Excluding peak [chr4	49122928	49123231	both.broad_peak_26439] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000	.]
Excluding peak [chr4	49151102	49151911	both.broad_peak_26440] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000	.]
Excluding peak [chr4	49645060	49645303	both.broad_peak_26441] which overlaps excluded region [chr4	49488472	49662085	centromeric_repeat	1000	.]
Excluding peak [chr4	49659456	49659760	both.broad_peak_26442] which overlaps excluded region [chr4	49488472	49662085	centromeric_repeat	1000	.]
Excluding peak [chr4	56194226	56194485	both.broad_peak_26481] which overlaps excluded region [chr4	56194229	56194584	Low_mappability_island	1000	.]
Excluding peak [chr4	68264592	68266730	both.broad_peak_26530] which overlaps excluded region [chr4	68264186	68266830	centromeric_repeat	1000	.]
Excluding peak [chr4	191032545	191032745	both.broad_peak_27751] which overlaps excluded region [chr4	191026302	191044344	telomeric_repeat	1000	.]
Excluding peak [chr5	46364115	46364315	both.broad_peak_28116] which overlaps excluded region [chr5	45908253	46411114	centromeric_repeat	1000	.]
Excluding peak [chr5	49450550	49450756	both.broad_peak_28117] which overlaps excluded region [chr5	49405493	49554574	centromeric_repeat	1000	.]
Excluding peak [chr5	49547478	49547699	both.broad_peak_28118] which overlaps excluded region [chr5	49405493	49554574	centromeric_repeat	1000	.]
Excluding peak [chr5	134259765	134260404	both.broad_peak_29117] which overlaps excluded region [chr5	134258949	134264271	Low_mappability_island	1000	.]
Excluding peak [chr5	134262625	134262877	both.broad_peak_29118] which overlaps excluded region [chr5	134258949	134264271	Low_mappability_island	1000	.]
Excluding peak [chr6	58776533	58779369	both.broad_peak_30874] which overlaps excluded region [chr6	58745955	58780547	centromeric_repeat	1000	.]
Excluding peak [chr7	43878412	43878832	both.broad_peak_32927] which overlaps excluded region [chr7	43878355	43878530	TAR1	1000	.]
Excluding peak [chr7	45291476	45291676	both.broad_peak_32976] which overlaps excluded region [chr7	45291517	45291740	Low_mappability_island	1000	.]
Excluding peak [chr7	57549361	57549585	both.broad_peak_33054] which overlaps excluded region [chr7	57544726	57556913	Satellite_repeat	1000	.]
Excluding peak [chr7	57957789	57957996	both.broad_peak_33055] which overlaps excluded region [chr7	57939184	58055539	centromeric_repeat	1000	.]
Excluding peak [chr7	61968705	61969761	both.broad_peak_33056] which overlaps excluded region [chr7	61054285	62454680	centromeric_repeat	1000	.]
Excluding peak [chr7	61986136	61986336	both.broad_peak_33057] which overlaps excluded region [chr7	61054285	62454680	centromeric_repeat	1000	.]
Excluding peak [chr7	64099785	64100002	both.broad_peak_33067] which overlaps excluded region [chr7	64090864	64105357	BSR/Beta	1000	.]
Excluding peak [chr7	64100838	64101105	both.broad_peak_33068] which overlaps excluded region [chr7	64090864	64105357	BSR/Beta	1000	.]
Excluding peak [chr7	100550706	100551292	both.broad_peak_33481] which overlaps excluded region [chr7	100550640	100551321	Low_mappability_island	1000	.]
Excluding peak [chr8	43092778	43097038	both.broad_peak_34830] which overlaps excluded region [chr8	43092737	43097573	Satellite_repeat	1000	.]
Excluding peak [chr8	43779474	43779699	both.broad_peak_34831] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000	.]
Excluding peak [chr8	43794100	43794746	both.broad_peak_34832] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000	.]
Excluding peak [chr8	43820539	43820739	both.broad_peak_34833] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000	.]
Excluding peak [chr8	43821992	43822192	both.broad_peak_34834] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000	.]
Excluding peak [chr8	46845309	46845549	both.broad_peak_34835] which overlaps excluded region [chr8	46838215	47457541	centromeric_repeat	1000	.]
Excluding peak [chr8	46852362	46852861	both.broad_peak_34836] which overlaps excluded region [chr8	46838215	47457541	centromeric_repeat	1000	.]
Excluding peak [chr8	100507997	100508253	both.broad_peak_35355] which overlaps excluded region [chr8	100508010	100508287	Low_mappability_island	1000	.]
Excluding peak [chr9	45356920	45357350	both.broad_peak_36413] which overlaps excluded region [chr9	45355954	45357644	telomeric_repeat	1000	.]
Excluding peak [chr9	45439723	45439970	both.broad_peak_36414] which overlaps excluded region [chr9	45435109	45443517	centromeric_repeat	1000	.]
Excluding peak [chr9	45441747	45442443	both.broad_peak_36415] which overlaps excluded region [chr9	45435109	45443517	centromeric_repeat	1000	.]
Excluding peak [chr9	66494045	66494608	both.broad_peak_36419] which overlaps excluded region [chr9	66494170	66494805	TAR1	1000	.]
Excluding peak [chr9	66824178	66824684	both.broad_peak_36421] which overlaps excluded region [chr9	66767710	66864329	centromeric_repeat	1000	.]
Excluding peak [chr9	66833083	66833633	both.broad_peak_36422] which overlaps excluded region [chr9	66767710	66864329	centromeric_repeat	1000	.]
Excluding peak [chr9	67339988	67340844	both.broad_peak_36425] which overlaps excluded region [chr9	67340080	67340661	TAR1	1000	.]
Excluding peak [chr9	68377361	68377574	both.broad_peak_36426] which overlaps excluded region [chr9	68376841	68377466	TAR1	1000	.]
Excluding peak [chr9	68412991	68414393	both.broad_peak_36427] which overlaps excluded region [chr9	68410775	68435115	Low_mappability_island	1000	.]
Excluding peak [chr9	70648541	70648768	both.broad_peak_36436] which overlaps excluded region [chr9	70648394	70648886	TAR1	1000	.]
chr1 peak count: 3667
chr2 peak count: 3154
chr3 peak count: 2528
chr4 peak count: 1814
chr5 peak count: 2042
chr6 peak count: 2483
chr7 peak count: 1999
chr8 peak count: 1647
chr9 peak count: 1475
chr10 peak count: 1815
chr11 peak count: 1878
chr12 peak count: 2078
chr13 peak count: 1026
chr14 peak count: 1275
chr15 peak count: 1140
chr16 peak count: 1211
chr17 peak count: 1664
chr18 peak count: 772
chr19 peak count: 1595
chr20 peak count: 864
chr21 peak count: 487
chr22 peak count: 662
Loaded 37276 peaks in 15.9435 seconds. (2338.01 peaks/second).

New maximum proper pair fragment length: 42 from [SRR891275.608	1123	chr1	569907	57	42M	=	569907	42	CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA	@@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG	XA:Z:chrM,+9359,42M,1;	MD:Z:42	NM:i:0	AS:i:42	XS:i:37	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 330 from [SRR891278.50	1123	chr1	569913	27	50M	=	570193	330	NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC	#1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH	XA:Z:chrM,+9365,50M,2;	MD:Z:0C49	NM:i:1	AS:i:49	XS:i:44	RG:Z:SRR891278	PG:Z:MarkDuplicates-4FB7F45F]
New maximum proper pair fragment length: 53 from [SRR891275.421	1187	chr1	569924	15	50M	=	569927	53	TGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACC	CCCFFFFFGHHHHIGIJIJIEHIGIIIJJGIJJJJGGGJJJJJGIIJJFI	XA:Z:chrM,+9376,50M,1;	MD:Z:50	NM:i:0	AS:i:50	XS:i:47	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 67 from [SRR891275.1617	99	chr1	2059335	60	50M	=	2059352	67	CACCTTAGCTCTGGACACGAATTTGCGGTCATTGCTGTTCTTGTGTCTCT	???DB?D8C:CD42C<EB))3ACDEAEAD6D><<*?DB<9?BBBD?9DD4	MD:Z:50	NM:i:0	AS:i:50	XS:i:0	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 112 from [SRR891275.176	99	chr1	2419720	60	50M	=	2419782	112	ATCCCTGGGACTGTAGGTGGGAAGGGCATTGCAAGGCACAGGGGCGGGGA	@BCFFDEDDHHHHHIJICGHI=GHIGIJJJJJIJIJIGHFHIJBHHDB87	MD:Z:50	NM:i:0	AS:i:50	XS:i:0	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 361 from [SRR891278.227	99	chr1	17047555	60	50M	=	17047866	361	GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT	@CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC	XA:Z:chr1,+144886802,48M2S,2;	MD:Z:50	NM:i:0	AS:i:50	XS:i:42	RG:Z:SRR891278	PG:Z:MarkDuplicates-4FB7F45F]
New maximum proper pair fragment length: 216 from [SRR891275.1770	163	chr1	18154381	60	50M	=	18154547	216	CAACTGTTTTGCTTACTCTGACTAATACAGAGAAGGGAGCCACAATATAC	C@CFFFDFGHHHHJJJJJJJJJJJJJIEIIHIJJJIGIJIJJJCHHIJJJ	MD:Z:50	NM:i:0	AS:i:50	XS:i:21	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 562 from [SRR891275.385	163	chr1	43042844	60	50M	=	43043356	562	AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA	CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII	MD:Z:50	NM:i:0	AS:i:50	XS:i:0	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 609 from [SRR891275.714	99	chr1	79875808	60	50M	=	79876367	609	GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG	@@@DDDFFFHAH<EFGGGG@EGECHIDHHAE<<*11?DB?9*?*:336?B	MD:Z:50	NM:i:0	AS:i:50	XS:i:30	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 424 from [SRR891278.592	163	chr1	238449255	60	50M	=	238449629	424	CCTGCAATTCTGAATAGGTCTGTGAATATACAGACTTTTTATTTGTACAT	B@@BDDFFHGHGHJGEHDFHGHDHHJCEGIIGGEHIJGIGEHIIIIGEIH	MD:Z:50	NM:i:0	AS:i:50	XS:i:0	RG:Z:SRR891278	PG:Z:MarkDuplicates-4FB7F45F]
New maximum proper pair fragment length: 633 from [SRR891278.342	99	chr2	4228733	60	50M	=	4229316	633	CATTTAATGCAAACTAATCTAGCTATTATCATCTGGAGCTGCAGGCTATA	CCCFFFFDHHGFHABDIGIIEGIIGCHCHIIIIIGHAEF):CCF;F;BDH	MD:Z:50	NM:i:0	AS:i:50	XS:i:20	RG:Z:SRR891278	PG:Z:MarkDuplicates-4FB7F45F]
New maximum proper pair fragment length: 649 from [SRR891278.1592	99	chr2	55845390	60	50M	=	55845989	649	GTGTGTTGACGATTTCCTGTTTCTTGCAGAGCGATTCACCGTTAAGGCTC	;1=+AB3BB<<?AC?EEAE+3A<B4CC93*:9C)?;DBD?68)?######	MD:Z:33C16	NM:i:1	AS:i:45	XS:i:0	RG:Z:SRR891278	PG:Z:MarkDuplicates-4FB7F45F]
Calculating TSS coverage...
Added TSS coverage for chr22; thread count=1
Added TSS coverage for chr21; thread count=1
Added TSS coverage for chr20; thread count=1
Added TSS coverage for chr19; thread count=1
Added TSS coverage for chr18; thread count=1
Added TSS coverage for chr17; thread count=1
Added TSS coverage for chr16; thread count=1
Added TSS coverage for chr15; thread count=1
Added TSS coverage for chr14; thread count=1
Added TSS coverage for chr13; thread count=1
Added TSS coverage for chr12; thread count=1
Added TSS coverage for chr11; thread count=1
Added TSS coverage for chr10; thread count=1
Added TSS coverage for chr9; thread count=1
Added TSS coverage for chr8; thread count=1
Added TSS coverage for chr7; thread count=1
Added TSS coverage for chr6; thread count=1
Added TSS coverage for chr5; thread count=1
Added TSS coverage for chr4; thread count=1
Added TSS coverage for chr3; thread count=1
Added TSS coverage for chr2; thread count=1
Added TSS coverage for chr1; thread count=1
All TSS jobs started. Waiting for last ones to complete.
Calculated TSS coverage in 0.140193 seconds.
Calculating TSS metrics...
Calculated TSS metrics in 0.000212974 seconds.
Calculating TSS metrics...
Calculated TSS metrics in 0.000219008 seconds.
Analyzed 1040 reads in 0.212587 seconds (4892.12 reads/second).

ataqv 1.3.1

Operating parameters
====================
Thread limit: 1
Ignoring read groups: no
Is single nucleus: no
TSS extension: 1000

Experiment information
======================
Organism: human
Description: a collector for unit tests
URL: https://theparkerlab.org

Reference genome configuration
==============================
Mitochondrial reference: chrM
Autosomal references: 
  1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
  20, 21, 22, chr1, chr2, chr3, chr4, chr5, chr6, chr7, chr8, chr9,
  chr10, chr11, chr12, chr13, chr14, chr15, chr16, chr17, chr18,
  chr19, chr20, chr21, chr22


Read Group
==========
ID: SRR891275
Library: SRR891275
Sample: GSM1155964
Description: a library of brutal tests?

Sequencing center: 
Sequencing date: 
Sequencing platform: ILLUMINA
Platform model: 
Platform unit: 
Flow order: 
Key sequence: 
Predicted median insert size: 
Programs: 

Metrics
-------

  Read Mapping Metrics
  --------------------
  Total reads: 520
  Total problems: 104 (20.000%)
  Properly paired and mapped reads: 416 (80.000%)
  Secondary reads: 10 (1.923%)
  Supplementary reads: 0 (0.000%)
  Duplicate reads: 155 (29.808% of all reads)

  Quality Indicators
  ------------------
  Short to mononucleosomal ratio: 1.281
  High quality, nonduplicate, properly paired, uniquely mapped autosomal alignments: 200
    as a percentage of autosomal reads: 91.324%
    as a percentage of all reads: 38.462%
  TSS enrichment: 6.000

  Paired Read Metrics
  -------------------
  Paired reads: 520 (100.000%)
  Paired and mapped reads: 424 (81.538%)
  FR reads: 416 (80.000000%)
  First of pair: 260 (50.000%)
  Second of pair: 260 (50.000%)
  Forward reads: 268 (51.538%)
  Reverse reads: 252 (48.462%)
  Forward mate reads: 261 (50.192%)
  Reverse mate reads: 259 (49.808%)

  Unmapped Read Metrics
  ---------------------
  Unmapped reads:                       9 (1.731%)
  Unmapped mate reads:                  2 (0.385%)
  Reads not passing quality controls:   0 (0.000%)
  Unpaired reads:                       0 (0.000%)
  Reads with zero mapping quality:      62 (11.923%)

  Aberrant Mapping Metrics
  ------------------------
  RF reads:                             9 (1.730769%)
  FF reads:                             6 (1.153846%)
  RR reads:                             8 (1.538462%)
  Reads that paired and mapped but...   
    on different chromosomes:           6 (1.154%)
    probably too far from their mates:  2 (0.385%) (longest proper fragment seems to be 609)
    just not properly:                  0 (0.000%)

  Autosomal/Mitochondrial Metrics
  -------------------------------
  Total autosomal reads: 219 (42.115% of all reads)
  Total mitochondrial reads: 177 (34.038% of all reads)
  Duplicate autosomal reads: 18 (8.219% of all autosomal reads)
  Duplicate mitochondrial reads: 93 (52.542% of all mitochondrial reads)


  Mapping Quality
  ---------------
  Mean MAPQ: 47.033
  Median MAPQ: 60.000
  Reads with MAPQ >=...
                   5: 439 (84.423%)
                  10: 439 (84.423%)
                  15: 438 (84.231%)
                  20: 436 (83.846%)
                  25: 435 (83.654%)
                  30: 420 (80.769%)

  Peak Metrics
  ------------
  Peak count: 37276

  High quality autosomal alignments that overlapped peaks: 23 (11.500% of all high quality autosomal alignments)
  Number of high quality autosomal alignments overlapping the top 10,000 peaks: 
          Top peak: 2 (1.000% of all high quality autosomal alignments)
      Top 10 peaks: 20 (10.000% of all high quality autosomal alignments)
     Top 100 peaks: 23 (11.500% of all high quality autosomal alignments)
    Top 1000 peaks: 23 (11.500% of all high quality autosomal alignments)
  Top 10,000 peaks: 23 (11.500% of all high quality autosomal alignments)

Read Group
==========
ID: SRR891278
Library: SRR891278
Sample: GSM1155967
Description: a library of brutal tests?

Sequencing center: 
Sequencing date: 
Sequencing platform: ILLUMINA
Platform model: 
Platform unit: 
Flow order: 
Key sequence: 
Predicted median insert size: 
Programs: 

Metrics
-------

  Read Mapping Metrics
  --------------------
  Total reads: 520
  Total problems: 90 (17.308%)
  Properly paired and mapped reads: 430 (82.692%)
  Secondary reads: 10 (1.923%)
  Supplementary reads: 0 (0.000%)
  Duplicate reads: 158 (30.385% of all reads)

  Quality Indicators
  ------------------
  Short to mononucleosomal ratio: 2.357
  High quality, nonduplicate, properly paired, uniquely mapped autosomal alignments: 200
    as a percentage of autosomal reads: 91.743%
    as a percentage of all reads: 38.462%
  TSS enrichment: 3.687

  Paired Read Metrics
  -------------------
  Paired reads: 520 (100.000%)
  Paired and mapped reads: 440 (84.615%)
  FR reads: 430 (82.692308%)
  First of pair: 259 (49.808%)
  Second of pair: 261 (50.192%)
  Forward reads: 261 (50.192%)
  Reverse reads: 259 (49.808%)
  Forward mate reads: 260 (50.000%)
  Reverse mate reads: 260 (50.000%)

  Unmapped Read Metrics
  ---------------------
  Unmapped reads:                       8 (1.538%)
  Unmapped mate reads:                  4 (0.769%)
  Reads not passing quality controls:   0 (0.000%)
  Unpaired reads:                       0 (0.000%)
  Reads with zero mapping quality:      49 (9.423%)

  Aberrant Mapping Metrics
  ------------------------
  RF reads:                             6 (1.153846%)
  FF reads:                             4 (0.769231%)
  RR reads:                             9 (1.730769%)
  Reads that paired and mapped but...   
    on different chromosomes:           8 (1.538%)
    probably too far from their mates:  2 (0.385%) (longest proper fragment seems to be 649)
    just not properly:                  0 (0.000%)

  Autosomal/Mitochondrial Metrics
  -------------------------------
  Total autosomal reads: 218 (41.923% of all reads)
  Total mitochondrial reads: 192 (36.923% of all reads)
  Duplicate autosomal reads: 17 (7.798% of all autosomal reads)
  Duplicate mitochondrial reads: 92 (47.917% of all mitochondrial reads)


  Mapping Quality
  ---------------
  Mean MAPQ: 48.044
  Median MAPQ: 60.000
  Reads with MAPQ >=...
                   5: 449 (86.346%)
                  10: 445 (85.577%)
                  15: 443 (85.192%)
                  20: 442 (85.000%)
                  25: 442 (85.000%)
                  30: 417 (80.192%)

  Peak Metrics
  ------------
  Peak count: 37276

  High quality autosomal alignments that overlapped peaks: 92 (46.000% of all high quality autosomal alignments)
  Number of high quality autosomal alignments overlapping the top 10,000 peaks: 
          Top peak: 2 (1.000% of all high quality autosomal alignments)
      Top 10 peaks: 20 (10.000% of all high quality autosomal alignments)
     Top 100 peaks: 92 (46.000% of all high quality autosomal alignments)
    Top 1000 peaks: 92 (46.000% of all high quality autosomal alignments)
  Top 10,000 peaks: 92 (46.000% of all high quality autosomal alignments)


[E::hts_open_format] Failed to open file "missing_alignment_file.bam" : No such file or directory
Read 411 excluded regions from exclude.dac.bed.gz.
Read 1649 excluded regions from exclude.duke.bed.gz.
Collecting metrics from test.bam.

Logging problematic reads to Test collector.problems.

Loading peaks for read group Test collector from test.peaks.gz.
Excluding peak [chr1	569780	570073	both.broad_peak_1] which overlaps excluded region [chr1	564449	570371	High_Mappability_island	1000.000	.]
Excluding peak [chr1	5727305	5727512	both.broad_peak_97] which overlaps excluded region [chr1	5725866	5736651	Low_mappability_island	1000.000	.]
Excluding peak [chr1	16840415	16841121	both.broad_peak_297] which overlaps excluded region [chr1	16839923	16841396	Low_mappability_island	1000.000	.]
Excluding peak [chr1	121354253	121354849	both.broad_peak_1896] which overlaps excluded region [chr1	121351474	121487059	centromeric_repeat	1000.000	.]
Excluding peak [chr1	121478396	121478755	both.broad_peak_1897] which overlaps excluded region [chr1	121351474	121487059	centromeric_repeat	1000.000	.]
Excluding peak [chr1	121484326	121485516	both.broad_peak_1898] which overlaps excluded region [chr1	121351474	121487059	centromeric_repeat	1000.000	.]
Excluding peak [chr1	142538265	142538603	both.broad_peak_1899] which overlaps excluded region [chr1	142535434	142543081	Satellite_repeat	1000.000	.]
Excluding peak [chr1	148928074	148928756	both.broad_peak_1971] which overlaps excluded region [chr1	148927799	148928362	TAR1	1000.000	.]
Excluding peak [chr10	38804202	38804431	both.broad_peak_4296] which overlaps excluded region [chr10	38772277	38819357	Satellite_repeat	1000.000	.]
Excluding peak [chr10	38817221	38818020	both.broad_peak_4297] which overlaps excluded region [chr10	38772277	38819357	Satellite_repeat	1000.000	.]
Excluding peak [chr10	38872037	38872278	both.broad_peak_4298] which overlaps excluded region [chr10	38868892	38889025	Satellite_repeat	1000.000	.]
Excluding peak [chr10	42355450	42355650	both.broad_peak_4299] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42358135	42358433	both.broad_peak_4300] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42364634	42365245	both.broad_peak_4301] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42379790	42380383	both.broad_peak_4302] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42384574	42385679	both.broad_peak_4303] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42392602	42392861	both.broad_peak_4304] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42396775	42396995	both.broad_peak_4305] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42398498	42400769	both.broad_peak_4306] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42404317	42404537	both.broad_peak_4307] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42408166	42408438	both.broad_peak_4308] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42442445	42442676	both.broad_peak_4309] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42527244	42528189	both.broad_peak_4310] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42529217	42530048	both.broad_peak_4311] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42534598	42534872	both.broad_peak_4312] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42596780	42597198	both.broad_peak_4313] which overlaps excluded region [chr10	42596676	42602082	Satellite_repeat	1000.000	.]
Excluding peak [chr10	42599471	42600289	both.broad_peak_4314] which overlaps excluded region [chr10	42596676	42602082	Satellite_repeat	1000.000	.]
Excluding peak [chr10	42817448	42818278	both.broad_peak_4315] which overlaps excluded region [chr10	42790522	42818398	Satellite_repeat	1000.000	.]
Excluding peak [chr11	189746	190314	both.broad_peak_5511] which overlaps excluded region [chr11	189419	190691	TAR1	1000.000	.]
Excluding peak [chr11	50731852	50732074	both.broad_peak_6138] which overlaps excluded region [chr11	50318471	50784078	centromeric_repeat	1000.000	.]
Excluding peak [chr11	51572059	51572261	both.broad_peak_6139] which overlaps excluded region [chr11	51567242	51594226	centromeric_repeat	1000.000	.]
Excluding peak [chr11	51579362	51580694	both.broad_peak_6140] which overlaps excluded region [chr11	51567242	51594226	centromeric_repeat	1000.000	.]
Excluding peak [chr11	51591018	51591457	both.broad_peak_6141] which overlaps excluded region [chr11	51567242	51594226	centromeric_repeat	1000.000	.]
Excluding peak [chr11	55006615	55007430	both.broad_peak_6142] which overlaps excluded region [chr11	54694046	55027975	centromeric_repeat	1000.000	.]
Excluding peak [chr11	73221686	73221937	both.broad_peak_6590] which overlaps excluded region [chr11	73221660	73221946	Low_mappability_island	1000.000	.]
Excluding peak [chr12	94193	94658	both.broad_peak_7396] which overlaps excluded region [chr12	94147	95158	TAR1	1000.000	.]
Excluding peak [chr12	34841382	34841617	both.broad_peak_7957] which overlaps excluded region [chr12	34432130	34857010	centromeric_repeat	1000.000	.]
Excluding peak [chr12	34846246	34846543	both.broad_peak_7958] which overlaps excluded region [chr12	34432130	34857010	centromeric_repeat	1000.000	.]
Excluding peak [chr12	38008155	38008894	both.broad_peak_7959] which overlaps excluded region [chr12	37989447	38441828	centromeric_repeat	1000.000	.]
Excluding peak [chr12	38023173	38023373	both.broad_peak_7960] which overlaps excluded region [chr12	37989447	38441828	centromeric_repeat	1000.000	.]
Excluding peak [chr12	118573678	118574095	both.broad_peak_9235] which overlaps excluded region [chr12	118573638	118573695	LSU-rRNA_Hsa	1000.000	.]
Excluding peak [chr12	127650467	127651165	both.broad_peak_9421] which overlaps excluded region [chr12	127650407	127651075	LSU-rRNA_Hsa	1000.000	.]
Excluding peak [chr14	32953483	32953821	both.broad_peak_10712] which overlaps excluded region [chr14	32953263	32954381	Low_mappability_island	1000.000	.]
Excluding peak [chr15	80444564	80445859	both.broad_peak_12630] which overlaps excluded region [chr15	80445513	80445569	(GAGTG)n	1000.000	.]
Excluding peak [chr16	60436	61192	both.broad_peak_12924] which overlaps excluded region [chr16	60058	61142	TAR1	1000.000	.]
Excluding peak [chr16	33866265	33866524	both.broad_peak_13513] which overlaps excluded region [chr16	33864355	34023306	centromeric_repeat	1000.000	.]
Excluding peak [chr16	33918664	33919304	both.broad_peak_13514] which overlaps excluded region [chr16	33864355	34023306	centromeric_repeat	1000.000	.]
Excluding peak [chr16	34009313	34009561	both.broad_peak_13515] which overlaps excluded region [chr16	33864355	34023306	centromeric_repeat	1000.000	.]
Excluding peak [chr16	46386270	46386795	both.broad_peak_13516] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000.000	.]
Excluding peak [chr16	46391235	46392140	both.broad_peak_13517] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000.000	.]
Excluding peak [chr16	46403548	46403849	both.broad_peak_13518] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000.000	.]
Excluding peak [chr16	46416804	46417405	both.broad_peak_13519] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000.000	.]
Excluding peak [chr16	46427429	46427991	both.broad_peak_13520] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000.000	.]
Excluding peak [chr17	22020593	22020916	both.broad_peak_14569] which overlaps excluded region [chr17	22018524	22032049	Low_mappability_island	1000.000	.]
Excluding peak [chr17	22252084	22253296	both.broad_peak_14570] which overlaps excluded region [chr17	22221073	22263006	centromeric_repeat	1000.000	.]
Excluding peak [chr17	22261278	22261740	both.broad_peak_14571] which overlaps excluded region [chr17	22221073	22263006	centromeric_repeat	1000.000	.]
Excluding peak [chr17	25264883	25265249	both.broad_peak_14572] which overlaps excluded region [chr17	25263010	25268059	Satellite_repeat	1000.000	.]
Excluding peak [chr17	41381728	41382265	both.broad_peak_14950] which overlaps excluded region [chr17	41381502	41382591	High_Mappability_island	1000.000	.]
Excluding peak [chr17	41465631	41466936	both.broad_peak_14957] which overlaps excluded region [chr17	41465562	41467288	High_Mappability_island	1000.000	.]
Excluding peak [chr17	51183057	51183341	both.broad_peak_15172] which overlaps excluded region [chr17	51183038	51183763	Low_mappability_island	1000.000	.]
Excluding peak [chr17	58602907	58603721	both.broad_peak_15290] which overlaps excluded region [chr17	58603715	58603738	(GAGTG)n	1000.000	.]
Excluding peak [chr18	111564	112042	both.broad_peak_15816] which overlaps excluded region [chr18	105658	112233	Satellite_repeat	1000.000	.]
Excluding peak [chr18	18512827	18513193	both.broad_peak_16011] which overlaps excluded region [chr18	18510894	18520356	centromeric_repeat	1000.000	.]
Excluding peak [chr18	18516045	18520399	both.broad_peak_16012] which overlaps excluded region [chr18	18510894	18520356	centromeric_repeat	1000.000	.]
Excluding peak [chr19	21776802	21777550	both.broad_peak_17342] which overlaps excluded region [chr19	21776132	21780768	BSR/Beta	1000.000	.]
Excluding peak [chr19	24169382	24170027	both.broad_peak_17364] which overlaps excluded region [chr19	24156856	24171961	BSR/Beta	1000.000	.]
Excluding peak [chr19	24474565	24474765	both.broad_peak_17369] which overlaps excluded region [chr19	24385474	24633168	centromeric_repeat	1000.000	.]
Excluding peak [chr19	24526069	24526320	both.broad_peak_17370] which overlaps excluded region [chr19	24385474	24633168	centromeric_repeat	1000.000	.]
Excluding peak [chr19	27731880	27733339	both.broad_peak_17371] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000.000	.]
Excluding peak [chr19	27738359	27738668	both.broad_peak_17372] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000.000	.]
Excluding peak [chr19	27756701	27756901	both.broad_peak_17373] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000.000	.]
Excluding peak [chr19	27801311	27801531	both.broad_peak_17374] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000.000	.]
Excluding peak [chr19	37784325	37784692	both.broad_peak_17536] which overlaps excluded region [chr19	37759473	37797722	centromeric_repeat	1000.000	.]
Excluding peak [chr19	42069917	42070450	both.broad_peak_17680] which overlaps excluded region [chr19	42069989	42071891	LSU-rRNA_Hsa	1000.000	.]
Excluding peak [chr2	89848588	89848836	both.broad_peak_19338] which overlaps excluded region [chr2	89830421	89880514	Satellite_repeat	1000.000	.]
Excluding peak [chr2	89872032	89872646	both.broad_peak_19339] which overlaps excluded region [chr2	89830421	89880514	Satellite_repeat	1000.000	.]
Excluding peak [chr2	89878336	89879257	both.broad_peak_19340] which overlaps excluded region [chr2	89830421	89880514	Satellite_repeat	1000.000	.]
Excluding peak [chr2	90449580	90449808	both.broad_peak_19342] which overlaps excluded region [chr2	90443001	90545431	Low_mappability_island	1000.000	.]
Excluding peak [chr2	91847848	91848177	both.broad_peak_19344] which overlaps excluded region [chr2	91847957	91848503	TAR1	1000.000	.]
Excluding peak [chr2	92272876	92273767	both.broad_peak_19345] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000.000	.]
Excluding peak [chr2	92281197	92281779	both.broad_peak_19346] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000.000	.]
Excluding peak [chr2	92284237	92284462	both.broad_peak_19347] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000.000	.]
Excluding peak [chr2	92290435	92291262	both.broad_peak_19348] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000.000	.]
Excluding peak [chr2	92296588	92297023	both.broad_peak_19349] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000.000	.]
Excluding peak [chr2	92305535	92305892	both.broad_peak_19350] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000.000	.]
Excluding peak [chr2	92317234	92317870	both.broad_peak_19351] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000.000	.]
Excluding peak [chr2	114361072	114362020	both.broad_peak_19697] which overlaps excluded region [chr2	114361054	114362417	TAR1	1000.000	.]
Excluding peak [chr2	132559385	132560425	both.broad_peak_19833] which overlaps excluded region [chr2	132560214	132560696	TAR1	1000.000	.]
Excluding peak [chr2	132996509	132996755	both.broad_peak_19834] which overlaps excluded region [chr2	132994855	133007983	ALR/Alpha	1000.000	.]
Excluding peak [chr2	149639210	149639450	both.broad_peak_19986] which overlaps excluded region [chr2	149639207	149639515	Low_mappability_island	1000.000	.]
Excluding peak [chr2	162135291	162136055	both.broad_peak_20150] which overlaps excluded region [chr2	162135000	162139241	Low_mappability_island	1000.000	.]
Excluding peak [chr20	26269111	26270030	both.broad_peak_21666] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000.000	.]
Excluding peak [chr20	26278258	26278484	both.broad_peak_21667] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000.000	.]
Excluding peak [chr20	26289332	26290609	both.broad_peak_21668] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000.000	.]
Excluding peak [chr20	26305634	26305887	both.broad_peak_21669] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000.000	.]
Excluding peak [chr20	26317322	26318676	both.broad_peak_21670] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000.000	.]
Excluding peak [chr20	29512475	29512675	both.broad_peak_21671] which overlaps excluded region [chr20	29511127	29514978	ALR/Alpha	1000.000	.]
Excluding peak [chr20	29517798	29518922	both.broad_peak_21672] which overlaps excluded region [chr20	29517710	29521147	centromeric_repeat	1000.000	.]
Excluding peak [chr20	29813756	29813985	both.broad_peak_21678] which overlaps excluded region [chr20	29803876	29833334	centromeric_repeat	1000.000	.]
Excluding peak [chr20	29831826	29832026	both.broad_peak_21679] which overlaps excluded region [chr20	29803876	29833334	centromeric_repeat	1000.000	.]
Excluding peak [chr20	62917250	62917592	both.broad_peak_22240] which overlaps excluded region [chr20	62916702	62918053	telomeric_repeat	1000.000	.]
Excluding peak [chr21	9825749	9827187	both.broad_peak_22241] which overlaps excluded region [chr21	9825451	9827612	High_Mappability_island	1000.000	.]
Excluding peak [chr21	10773372	10773572	both.broad_peak_22242] which overlaps excluded region [chr21	10697886	10860890	centromeric_repeat	1000.000	.]
Excluding peak [chr21	11186125	11187338	both.broad_peak_22243] which overlaps excluded region [chr21	11186054	11188131	Satellite_repeat	1000.000	.]
Excluding peak [chr22	18878342	18878659	both.broad_peak_22759] which overlaps excluded region [chr22	18876789	18884510	Satellite_repeat	1000.000	.]
Excluding peak [chr22	18879876	18880128	both.broad_peak_22760] which overlaps excluded region [chr22	18876789	18884510	Satellite_repeat	1000.000	.]
Excluding peak [chr22	18883583	18883799	both.broad_peak_22761] which overlaps excluded region [chr22	18876789	18884510	Satellite_repeat	1000.000	.]
Excluding peak [chr22	22652231	22653042	both.broad_peak_22847] which overlaps excluded region [chr22	22652105	22652554	TAR1	1000.000	.]
Excluding peak [chr3	25508907	25509133	both.broad_peak_23723] which overlaps excluded region [chr3	25508897	25509131	Low_mappability_island	1000.000	.]
Excluding peak [chr3	73159761	73160669	both.broad_peak_24512] which overlaps excluded region [chr3	73159606	73161131	snRNA	1000.000	.]
Excluding peak [chr3	96336804	96337073	both.broad_peak_24578] which overlaps excluded region [chr3	96335934	96337436	Low_mappability_island	1000.000	.]
Excluding peak [chr3	196625608	196625808	both.broad_peak_25903] which overlaps excluded region [chr3	196625514	196625860	Satellite_repeat	1000.000	.]
Excluding peak [chr4	49094768	49094968	both.broad_peak_26437] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000.000	.]
Excluding peak [chr4	49107449	49107766	both.broad_peak_26438] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000.000	.]
Excluding peak [chr4	49122928	49123231	both.broad_peak_26439] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000.000	.]
Excluding peak [chr4	49151102	49151911	both.broad_peak_26440] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000.000	.]
Excluding peak [chr4	49645060	49645303	both.broad_peak_26441] which overlaps excluded region [chr4	49488472	49662085	centromeric_repeat	1000.000	.]
Excluding peak [chr4	49659456	49659760	both.broad_peak_26442] which overlaps excluded region [chr4	49488472	49662085	centromeric_repeat	1000.000	.]
Excluding peak [chr4	56194226	56194485	both.broad_peak_26481] which overlaps excluded region [chr4	56194229	56194584	Low_mappability_island	1000.000	.]
Excluding peak [chr4	68264592	68266730	both.broad_peak_26530] which overlaps excluded region [chr4	68264186	68266830	centromeric_repeat	1000.000	.]
Excluding peak [chr4	191032545	191032745	both.broad_peak_27751] which overlaps excluded region [chr4	191026302	191044344	telomeric_repeat	1000.000	.]
Excluding peak [chr5	46364115	46364315	both.broad_peak_28116] which overlaps excluded region [chr5	45908253	46411114	centromeric_repeat	1000.000	.]
Excluding peak [chr5	49450550	49450756	both.broad_peak_28117] which overlaps excluded region [chr5	49405493	49554574	centromeric_repeat	1000.000	.]
Excluding peak [chr5	49547478	49547699	both.broad_peak_28118] which overlaps excluded region [chr5	49405493	49554574	centromeric_repeat	1000.000	.]
Excluding peak [chr5	134259765	134260404	both.broad_peak_29117] which overlaps excluded region [chr5	134258949	134264271	Low_mappability_island	1000.000	.]
Excluding peak [chr5	134262625	134262877	both.broad_peak_29118] which overlaps excluded region [chr5	134258949	134264271	Low_mappability_island	1000.000	.]
Excluding peak [chr6	58776533	58779369	both.broad_peak_30874] which overlaps excluded region [chr6	58745955	58780547	centromeric_repeat	1000.000	.]
Excluding peak [chr7	43878412	43878832	both.broad_peak_32927] which overlaps excluded region [chr7	43878355	43878530	TAR1	1000.000	.]
Excluding peak [chr7	45291476	45291676	both.broad_peak_32976] which overlaps excluded region [chr7	45291517	45291740	Low_mappability_island	1000.000	.]
Excluding peak [chr7	57549361	57549585	both.broad_peak_33054] which overlaps excluded region [chr7	57544726	57556913	Satellite_repeat	1000.000	.]
Excluding peak [chr7	57957789	57957996	both.broad_peak_33055] which overlaps excluded region [chr7	57939184	58055539	centromeric_repeat	1000.000	.]
Excluding peak [chr7	61968705	61969761	both.broad_peak_33056] which overlaps excluded region [chr7	61054285	62454680	centromeric_repeat	1000.000	.]
Excluding peak [chr7	61986136	61986336	both.broad_peak_33057] which overlaps excluded region [chr7	61054285	62454680	centromeric_repeat	1000.000	.]
Excluding peak [chr7	64099785	64100002	both.broad_peak_33067] which overlaps excluded region [chr7	64090864	64105357	BSR/Beta	1000.000	.]
Excluding peak [chr7	64100838	64101105	both.broad_peak_33068] which overlaps excluded region [chr7	64090864	64105357	BSR/Beta	1000.000	.]
Excluding peak [chr7	100550706	100551292	both.broad_peak_33481] which overlaps excluded region [chr7	100550640	100551321	Low_mappability_island	1000.000	.]
Excluding peak [chr8	43092778	43097038	both.broad_peak_34830] which overlaps excluded region [chr8	43092737	43097573	Satellite_repeat	1000.000	.]
Excluding peak [chr8	43779474	43779699	both.broad_peak_34831] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000.000	.]
Excluding peak [chr8	43794100	43794746	both.broad_peak_34832] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000.000	.]
Excluding peak [chr8	43820539	43820739	both.broad_peak_34833] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000.000	.]
Excluding peak [chr8	43821992	43822192	both.broad_peak_34834] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000.000	.]
Excluding peak [chr8	46845309	46845549	both.broad_peak_34835] which overlaps excluded region [chr8	46838215	47457541	centromeric_repeat	1000.000	.]
Excluding peak [chr8	46852362	46852861	both.broad_peak_34836] which overlaps excluded region [chr8	46838215	47457541	centromeric_repeat	1000.000	.]
Excluding peak [chr8	100507997	100508253	both.broad_peak_35355] which overlaps excluded region [chr8	100508010	100508287	Low_mappability_island	1000.000	.]
Excluding peak [chr9	45356920	45357350	both.broad_peak_36413] which overlaps excluded region [chr9	45355954	45357644	telomeric_repeat	1000.000	.]
Excluding peak [chr9	45439723	45439970	both.broad_peak_36414] which overlaps excluded region [chr9	45435109	45443517	centromeric_repeat	1000.000	.]
Excluding peak [chr9	45441747	45442443	both.broad_peak_36415] which overlaps excluded region [chr9	45435109	45443517	centromeric_repeat	1000.000	.]
Excluding peak [chr9	66494045	66494608	both.broad_peak_36419] which overlaps excluded region [chr9	66494170	66494805	TAR1	1000.000	.]
Excluding peak [chr9	66824178	66824684	both.broad_peak_36421] which overlaps excluded region [chr9	66767710	66864329	centromeric_repeat	1000.000	.]
Excluding peak [chr9	66833083	66833633	both.broad_peak_36422] which overlaps excluded region [chr9	66767710	66864329	centromeric_repeat	1000.000	.]
Excluding peak [chr9	67339988	67340844	both.broad_peak_36425] which overlaps excluded region [chr9	67340080	67340661	TAR1	1000.000	.]
Excluding peak [chr9	68377361	68377574	both.broad_peak_36426] which overlaps excluded region [chr9	68376841	68377466	TAR1	1000.000	.]
Excluding peak [chr9	68412991	68414393	both.broad_peak_36427] which overlaps excluded region [chr9	68410775	68435115	Low_mappability_island	1000.000	.]
Excluding peak [chr9	70648541	70648768	both.broad_peak_36436] which overlaps excluded region [chr9	70648394	70648886	TAR1	1000.000	.]
chr1 peak count: 3667
chr2 peak count: 3154
chr3 peak count: 2528
chr4 peak count: 1814
chr5 peak count: 2042
chr6 peak count: 2483
chr7 peak count: 1999
chr8 peak count: 1647
chr9 peak count: 1475
chr10 peak count: 1815
chr11 peak count: 1878
chr12 peak count: 2078
chr13 peak count: 1026
chr14 peak count: 1275
chr15 peak count: 1140
chr16 peak count: 1211
chr17 peak count: 1664
chr18 peak count: 772
chr19 peak count: 1595
chr20 peak count: 864
chr21 peak count: 487
chr22 peak count: 662
Loaded 37276 peaks in 15.837 seconds. (2353.787 peaks/second).

New maximum proper pair fragment length: 42 from [SRR891275.608	1123	chr1	569907	57	42M	=	569907	42	CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA	@@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG	XA:Z:chrM,+9359,42M,1;	MD:Z:42	NM:i:0	AS:i:42	XS:i:37	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 330 from [SRR891278.50	1123	chr1	569913	27	50M	=	570193	330	NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC	#1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH	XA:Z:chrM,+9365,50M,2;	MD:Z:0C49	NM:i:1	AS:i:49	XS:i:44	RG:Z:SRR891278	PG:Z:MarkDuplicates-4FB7F45F]
New maximum proper pair fragment length: 361 from [SRR891278.227	99	chr1	17047555	60	50M	=	17047866	361	GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT	@CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC	XA:Z:chr1,+144886802,48M2S,2;	MD:Z:50	NM:i:0	AS:i:50	XS:i:42	RG:Z:SRR891278	PG:Z:MarkDuplicates-4FB7F45F]
New maximum proper pair fragment length: 562 from [SRR891275.385	163	chr1	43042844	60	50M	=	43043356	562	AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA	CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII	MD:Z:50	NM:i:0	AS:i:50	XS:i:0	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 609 from [SRR891275.714	99	chr1	79875808	60	50M	=	79876367	609	GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG	@@@DDDFFFHAH<EFGGGG@EGECHIDHHAE<<*11?DB?9*?*:336?B	MD:Z:50	NM:i:0	AS:i:50	XS:i:30	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 633 from [SRR891278.342	99	chr2	4228733	60	50M	=	4229316	633	CATTTAATGCAAACTAATCTAGCTATTATCATCTGGAGCTGCAGGCTATA	CCCFFFFDHHGFHABDIGIIEGIIGCHCHIIIIIGHAEF):CCF;F;BDH	MD:Z:50	NM:i:0	AS:i:50	XS:i:20	RG:Z:SRR891278	PG:Z:MarkDuplicates-4FB7F45F]
New maximum proper pair fragment length: 649 from [SRR891278.1592	99	chr2	55845390	60	50M	=	55845989	649	GTGTGTTGACGATTTCCTGTTTCTTGCAGAGCGATTCACCGTTAAGGCTC	;1=+AB3BB<<?AC?EEAE+3A<B4CC93*:9C)?;DBD?68)?######	MD:Z:33C16	NM:i:1	AS:i:45	XS:i:0	RG:Z:SRR891278	PG:Z:MarkDuplicates-4FB7F45F]
Analyzed 1040 reads in 0.024 seconds (42650.698 reads/second).

ataqv 1.3.1

Operating parameters
====================
Thread limit: 1
Ignoring read groups: yes
Is single nucleus: no

Experiment information
======================
Organism: human
Description: a collector for unit tests
URL: https://theparkerlab.org

Reference genome configuration
==============================
Mitochondrial reference: chrM
Autosomal references: 
  1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
  20, 21, 22, chr1, chr2, chr3, chr4, chr5, chr6, chr7, chr8, chr9,
  chr10, chr11, chr12, chr13, chr14, chr15, chr16, chr17, chr18,
  chr19, chr20, chr21, chr22


Read Group
==========
ID: Test collector
Library: Test collector
Sample: Test collector
Description: a library of brutal tests?

Sequencing center: 
Sequencing date: 
Sequencing platform: 
Platform model: 
Platform unit: 
Flow order: 
Key sequence: 
Predicted median insert size: 
Programs: 

Metrics
-------

  Read Mapping Metrics
  --------------------
  Total reads: 1040
  Total problems: 194 (18.654%)
  Properly paired and mapped reads: 846 (81.346%)
  Secondary reads: 20 (1.923%)
  Supplementary reads: 0 (0.000%)
  Duplicate reads: 313 (30.096% of all reads)

  Quality Indicators
  ------------------
  Short to mononucleosomal ratio: 1.783
  High quality, nonduplicate, properly paired, uniquely mapped autosomal alignments: 400
    as a percentage of autosomal reads: 91.533%
    as a percentage of all reads: 38.462%

  Paired Read Metrics
  -------------------
  Paired reads: 1040 (100.000%)
  Paired and mapped reads: 864 (83.077%)
  FR reads: 846 (81.346154%)
  First of pair: 519 (49.904%)
  Second of pair: 521 (50.096%)
  Forward reads: 529 (50.865%)
  Reverse reads: 511 (49.135%)
  Forward mate reads: 521 (50.096%)
  Reverse mate reads: 519 (49.904%)

  Unmapped Read Metrics
  ---------------------
  Unmapped reads:                       17 (1.635%)
  Unmapped mate reads:                  6 (0.577%)
  Reads not passing quality controls:   0 (0.000%)
  Unpaired reads:                       0 (0.000%)
  Reads with zero mapping quality:      111 (10.673%)

  Aberrant Mapping Metrics
  ------------------------
  RF reads:                             15 (1.442308%)
  FF reads:                             10 (0.961538%)
  RR reads:                             17 (1.634615%)
  Reads that paired and mapped but...   
    on different chromosomes:           14 (1.346%)
    probably too far from their mates:  4 (0.385%) (longest proper fragment seems to be 649)
    just not properly:                  0 (0.000%)

  Autosomal/Mitochondrial Metrics
  -------------------------------
  Total autosomal reads: 437 (42.019% of all reads)
  Total mitochondrial reads: 369 (35.481% of all reads)
  Duplicate autosomal reads: 35 (8.009% of all autosomal reads)
  Duplicate mitochondrial reads: 185 (50.136% of all mitochondrial reads)


  Mapping Quality
  ---------------
  Mean MAPQ: 47.538
  Median MAPQ: 60.000
  Reads with MAPQ >=...
                   5: 888 (85.385%)
                  10: 884 (85.000%)
                  15: 881 (84.712%)
                  20: 878 (84.423%)
                  25: 877 (84.327%)
                  30: 837 (80.481%)

  Peak Metrics
  ------------
  Peak count: 37276

  High quality autosomal alignments that overlapped peaks: 115 (28.750% of all high quality autosomal alignments)
  Number of high quality autosomal alignments overlapping the top 10,000 peaks: 
          Top peak: 2 (0.500% of all high quality autosomal alignments)
      Top 10 peaks: 20 (5.000% of all high quality autosomal alignments)
     Top 100 peaks: 115 (28.750% of all high quality autosomal alignments)
    Top 1000 peaks: 115 (28.750% of all high quality autosomal alignments)
  Top 10,000 peaks: 115 (28.750% of all high quality autosomal alignments)


Read 411 excluded regions from exclude.dac.bed.gz.
Read 1649 excluded regions from exclude.duke.bed.gz.
Collecting metrics from test.bam.

Logging problematic reads to Test collector.problems.

Loading peaks for read group Test collector from notthere.peaks.gz.
Read 411 excluded regions from exclude.dac.bed.gz.
Read 1649 excluded regions from exclude.duke.bed.gz.
Loading TSS file 'notthere.bed.gz'.
===============================================================================
test cases:  54 |  53 passed | 1 failed
assertions: 241 | 240 passed | 1 failed

make[1]: *** [Makefile:187: test] Error 1
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
dh_auto_test: error: make -j4 test returned exit code 2
make: *** [debian/rules:12: binary-arch] Error 25
dpkg-buildpackage: error: debian/rules binary-arch subprocess returned exit status 2
--------------------------------------------------------------------------------
Build finished at 2024-05-18T19:48:49Z

Finished
--------


+------------------------------------------------------------------------------+
| Cleanup                                                                      |
+------------------------------------------------------------------------------+

Purging /<<BUILDDIR>>
Not removing build depends: as requested
E: Build failure (dpkg-buildpackage died)

+------------------------------------------------------------------------------+
| Summary                                                                      |
+------------------------------------------------------------------------------+

Build Architecture: s390x
Build Type: any
Build-Space: 109488
Build-Time: 202
Distribution: noble
Fail-Stage: build
Host Architecture: s390x
Install-Time: 32
Job: ataqv_1.3.1+ds-2build3.dsc
Machine Architecture: s390x
Package: ataqv
Package-Time: 237
Source-Version: 1.3.1+ds-2build3
Space: 109488
Status: attempted
Version: 1.3.1+ds-2build3
--------------------------------------------------------------------------------
Finished at 2024-05-18T19:48:49Z
Build needed 00:03:57, 109488k disk space
E: Build failure (dpkg-buildpackage died)
RUN: /usr/share/launchpad-buildd/bin/in-target scan-for-processes --backend=chroot --series=noble --arch=s390x PACKAGEBUILD-28294924
Scanning for processes to kill in build PACKAGEBUILD-28294924